Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106006-1 Similarity: 0.969 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA106006-1
Gene: SUPT5H_1
MFE: -33.773
ENS: 0.774
Length: 126.
Predicted Ligands:
cobalamin - 10/20
TPP - 4/20
FMN - 3/20
 RS: URS0000AB88B5_561180
MFE: -35.684
Ligand: TPP
Species: Bifidobacterium gallicum DSM 20093 TPP riboswitch (THI element)
 RS: URS0001A06A59_2653162
MFE: -45.115
Ligand: FMN
Species: Pseudoclavibacter sp. 8L FMN
 RS: URS0000DAB4A6_1797907
MFE: -47.773
Ligand: TPP
Species: Deltaproteobacteria bacterium RIFOXYD2_FULL_66_9 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106006-1 URS0000AB88B5_561180 URS0001A06A59_2653162 URS0000DAB4A6_1797907
Length 126. 126. 125. 127.
Similarity - 0.969 0.968 0.967
Ensemble Norm 0.774 - - -
MFE -33.773 -35.684 -45.115 -47.773
Ligands - TPP FMN TPP
Gene SUPT5H - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.002 2.004 7.
Length SE - 0. 1. 1.
Lev Distance - 34. 41. 39.
UBS 11. 9. 12. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 1.
ILR 2. 1. 2. 4.
H 2. 2. 2. 2.
BL 6. 3. 6. 5.
BR 6. 6. 6. 6.
UN 0.159 0.198 0.096 0.142

Sequences

Field Description
UTR seq + 25 cucgcgagaggacccgucagccccagucaggcgucgugcgaacagcagcugguaccgaaggcggagguggagcccgagagaacggguagguucagcggaagATGTCGGACAGCGAGGACAGCAACT
UTR dot + 25 .(((((.((.(.((.(.(…….).).))).)).)))))……((((…((((…….(.(((((((((……)))))…)))).)……..)))).))))………….
RS 1 seq GGAAUCAAGCAGGGGGGCCUGUGGAGUCAAGCAUUGUGCUUGGUUCAGCAAGCUGAGAUUGGCGUUACGCCUGACCCUUCGAACCUGUUGGUUAGAACCAGUGUAGGGAGCGUUCGCAAUGAAUAU
RS 1 dot .((((((((((.((..((.((……)).)).)).))))))))))……………(((..((((….((((((.((((….)))).))……..)))).)))).)))………
RS 2 seq AACAUGCUCCGGGGUCGGUGAAAGUCCGAACCGGCGGUGAGAGUCCGCGACCCGCUCGUCCGCGAGCGGUUGACCUGGUGGAAUUCCGGGACCGACGGUUAAAGUCCGGAUGGUAGGUGCAUGGG
RS 2 dot …..(((((((..((((…….)))).)))).)))……(((.((((.((.((((((.((((.((((.(((((…….)))))..)))).))…..)))))))))).))).).))).
RS 3 seq AAAUACCGCCAGGGGUGCAUUUCGCUGAGAGCUCCGGGGGGACGCACCGCGCGCGCCAUCCCCUUCGGGCAACCCGUCGAACCUGACCCGGGUAAUGCCGGCGCAGGGAGCGUGGUCCUCUUCGAAC
RS 3 dot ……(((..(.(((((.((((.(((…….))).)))).))))).)..)))(((((((((.(.((((((((((((….))))..))))..)))).)…)))).).))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table