Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106081 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA106081
Gene: SURF1
MFE: -15.825
ENS: 0.813
Length: 57.
Predicted Ligands:
glutamine - 18/20
TPP - 1/20
fluoride - 1/20
 RS: URS0000DB68A2_1805093
MFE: -15.796
Ligand: TPP
Species: Crenarchaeota archaeon 13_1_20CM_2_51_8 TPP riboswitch (THI element)
 RS: URS0000C57952_12908
MFE: -10.623
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C17067_12908
MFE: -13.223
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106081 URS0000DB68A2_1805093 URS0000C57952_12908 URS0000C17067_12908
Length 57. 57. 57. 56.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.813 - - -
MFE -15.825 -15.796 -10.623 -13.223
Ligands - TPP glutamine glutamine
Gene SURF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.008 6.008 6.007
Length SE - 0. 0. 1.
Lev Distance - 14. 14. 13.
UBS 3. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 1. 0. 0. 0.
H 1. 1. 2. 2.
BL 1. 1. 2. 2.
BR 1. 1. 2. 2.
UN 0.351 0.263 0.263 0.268

Sequences

Field Description
UTR seq + 25 gcgucccggaagcgcccgcggggccgggugcgATGGAACTGAAAAATCTGGAGTATA
UTR dot + 25 ..((.(((…(((((((……)))))))..))).))………………
RS 1 seq CGACCCUUUGAACCUGAUCCGGGUAAUGCCGGCGGAGGGACGAUACGAAGCCUGAUU
RS 1 dot ((.(((((((……..((((……))))))))))).))……………
RS 2 seq CACGUUCAUCACUAUUUUUUGAGUGACGGAAGUAGACGAAAGUCGAAGGAACGCAUG
RS 2 dot .((.(((.(((((……..))))).))).)).(((….)))………….
RS 3 seq CACGUUCAUCACUCUUUUAGGGUGACGGAAGUAGACGAAAGUCGAAGGAACGCAUG
RS 3 dot .((.(((.(((((((…))))))).))).)).(((….)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table