Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106117 Similarity: 0.984 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA106117
Gene: SUV39H1
MFE: -19.146
ENS: 0.865
Length: 70.
Predicted Ligands:
homocysteine - 6/20
fluoride - 5/20
purine - 5/20
 RS: URS0000BFB91D_56193
MFE: -22.722
Ligand: fluoride
Species: Sphingobium chungbukense Fluoride riboswitch
 RS: URS000080DF85_672
MFE: -15.550
Ligand: purine
Species: Vibrio vulnificus A-riboswitch from Vibrio vulnificus (PDB 1Y26, chain X)
 RS: URS000080E2A9_672
MFE: -18.550
Ligand: adenine
Species: Vibrio vulnificus strain 93U204 chromosome II, adenine riboswitch aptamer domain from Vibrio vulnificus (PDB 5SWE, chain X)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106117 URS0000BFB91D_56193 URS000080DF85_672 URS000080E2A9_672
Length 70. 71. 71. 71.
Similarity - 0.984 0.984 0.984
Ensemble Norm 0.865 - - -
MFE -19.146 -22.722 -15.550 -18.550
Ligands - fluoride purine adenine
Gene SUV39H1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 2.001 2.001
Length SE - 1. 1. 1.
Lev Distance - 18. 20. 20.
UBS 7. 8. 6. 6.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 3.
ILR 2. 2. 2. 2.
H 1. 1. 1. 1.
BL 2. 4. 2. 2.
BR 1. 2. 1. 1.
UN 0.029 0.014 0. 0.

Sequences

Field Description
UTR seq + 25 cucgcgaggccggcuaggcccgaaugucguuagccguggggaaagATGGTGGGGATGAGTCGCCTGAGAA
UTR dot + 25 (((…(((.(((((…(((.(…(((((..((….))…)))))).)))…)))))))))))..
RS 1 seq GGCAUGGACGGCGAUGGAUUUCCGCCUGGCUUCGGCCGAACCGCCUCCGGGCUGAUGAUUCCUACCUGCUG
RS 1 dot ((((.((..((.(((.(…((.((((((…(((…..)))…)))))).))).)))))..)))))).
RS 2 seq CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
RS 2 dot (((((((((..(((…….((.(((((..(.((….)))..))))).))…….))))))))))))
RS 3 seq GGGAAGAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUCUUCCC
RS 3 dot (((((((((..(((…….((.(((((..(.((….)))..))))).))…….))))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table