Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106202 Similarity: 0.963 Similarity: 0.956 Similarity: 0.956
UTR: 5HSAA106202
Gene: SYCP3
MFE: -48.535
ENS: 0.755
Length: 150.
Predicted Ligands:
SAM - 14/20
FMN - 4/20
cobalamin - 2/20
 RS: URS0000AB735E_357808
MFE: -64.257
Ligand: SAM
Species: Roseiflexus sp. RS-1 SAM riboswitch (S box leader)
 RS: URS000232ED24_1618778
MFE: -30.044
Ligand: cobalamin
Species: Candidatus Nomurabacteria bacterium GW2011_GWF2_43_24 Cobalamin riboswitch
 RS: URS0000C774B6_1609099
MFE: -57.623
Ligand: SAM
Species: Streptomyces sp. NRRL F-6602 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106202 URS0000AB735E_357808 URS000232ED24_1618778 URS0000C774B6_1609099
Length 150. 149. 150. 151.
Similarity - 0.963 0.956 0.956
Ensemble Norm 0.755 - - -
MFE -48.535 -64.257 -30.044 -57.623
Ligands - SAM cobalamin SAM
Gene SYCP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.004 20.020 14.008
Length SE - 1. 0. 1.
Lev Distance - 44. 50. 52.
UBS 9. 11. 10. 12.
BS 1. 1. 0. 0.
ILL 1. 1. 3. 1.
ILR 2. 4. 2. 4.
H 3. 3. 4. 3.
BL 6. 5. 3. 6.
BR 3. 2. 1. 3.
UN 0.113 0.054 0.253 0.205

Sequences

Field Description
UTR seq + 25 agaagcgucgcggagaaggggccaccucaggugaagcgcgcuuguggaggaguuguggaggacgccugucgacgaccaguaacugguccucggccauugcgguguguuucaggaagcaucuaaauATGGTGTCCTCCGGAAAAAAGTATT
UTR dot + 25 ..(((((.(((……((((…))))…….)))))))).(((((((.((.(((((.(((((.(((((.((((((…)))))).)))))……))))).))))).))..((((…….)))))))))))…………
RS 1 seq UGCUCAUCCAGAGGAGUGGAGGGACCGGCCCGAUGAAGCUCCGCCAACCCGUAGCCACUGGAUCGAGCAGCCGGUGCGAUACGCGCCGCUUCUCGACACUGGCAGGCUAUAGGGUGGCAAUUCCGGCAGCGCAGGCUGGAAGAUGAGUG
RS 1 dot .(((((((….((((((..(((…..)))..)…)))))(((.((((((((((.((((.(((((.((.(((((((…))))))))).)))))..))))..)))))).)))))))..(((((((…….)))))))))))))).
RS 2 seq GUAAGUAUAUACUAAAUAGGUUCGUUUAAAAAUCAAAAGAAGUGAUUGGGGAAACCGGUUAGAUUCCGGUACAGUGCCGCUACGGUAAGUCCCGAACACCAACAGGUGGAGGGAACAAGUCCGACUAUCAAUCAUUUUACGUGUCCCGUA
RS 2 dot ………………((((……..))))…….(((.((.((((.((((..(((….(((((…))))))))))))…)))).)))))…..(((((..(((…..)))..)))))……..((((…..))))
RS 3 seq AGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGUUGAAGCCCCGGCAACCAUCCCGCGAUCCGCGUGUACGCGGAAUCUCCAGGCGAGACCGCCUCGUGGGGACGGUGCCAAUUCCGGCCCGUGACGAGAUACGGCACGGGGAAGAUGAGGA
RS 3 dot …………(((((((.(((…..))).))…)))))(((.(((.((((((((…(((.((.((((((…)))..)))..))))).))))))))..))))))……..((((((.((…..)).))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table