Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106209 Similarity: 0.935 Similarity: 0.934 Similarity: 0.934
UTR: 5HSAA106209
Gene: SYDE2
MFE: -47.655
ENS: 0.881
Length: 209.
Predicted Ligands:
cobalamin - 11/20
glucosamine - 9/20

 RS: URS000231EB1D_1895815
MFE: -84.310
Ligand: cobalamin
Species: Rhizobiales bacterium 65-79 Cobalamin riboswitch
 RS: URS0000C675C6_1413510
MFE: -58.356
Ligand: glucosamine
Species: Staphylococcus aureus C0673 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000DA75EB_1739409
MFE: -41.724
Ligand: glucosamine
Species: Staphylococcus sp. HMSC078E07 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106209 URS000231EB1D_1895815 URS0000C675C6_1413510 URS0000DA75EB_1739409
Length 209. 209. 209. 211.
Similarity - 0.935 0.934 0.934
Ensemble Norm 0.881 - - -
MFE -47.655 -84.310 -58.356 -41.724
Ligands - cobalamin glucosamine glucosamine
Gene SYDE2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 21.003 14.001 12.
Length SE - 0. 0. 4.
Lev Distance - 78. 82. 77.
UBS 10. 11. 12. 12.
BS 0. 4. 0. 0.
ILL 4. 5. 4. 2.
ILR 2. 2. 4. 3.
H 3. 4. 4. 4.
BL 3. 2. 1. 4.
BR 3. 4. 2. 4.
UN 0.163 0.110 0.139 0.142

Sequences

Field Description
UTR seq + 25 ugcgugaaaaccguguccugucggugccuccagaccaaagaauuacgcugacagguaggauacuuugcgaugaaaaugcuagcaccgcgagccuuacuguuuaccgacugggcuucugucuuaagagccaagaaaaaguuauguuuuugcgacagauuuauuugaaaaugccuaugggucuucaATGCACGACCTGCCCCCTGACTCGG
UTR dot + 25 …………..((((.(((((((…………………..(((((..(((….((((((.((……….)).)))))))))..)))))))))))).)))).((((((.(((((((…………..))))))).))))))………………((((((……(((…..)))…..)))))).
RS 1 seq UAUGAAUCCGCCUGCCAAGGUUCCUCGGGGGCGCACAACUCCCGAGGCUAAGAGGGAAGCCGGUGACUUUCGAGGAAGGCCGGCGCUGCCCCCGCAACUGUAGGCGGCGAGCCAAGCUCAUUCAUGUCACUGAGGCGGAAAAGCCUCGGGAAGACGAGCUAAGGCGACGACCCGCGAGCCAGGAGACCUGCCUUGGCGCAACAACGUCC
RS 1 dot …….((((((((…((((…(((((((((…..((((……….)))).((((((..((((….)))))))))))).))))))).))))))))))))…(((.(((((..((…((.(((((((……))))))))).)).)))))..)))((((….((..((((((……..))))))))…..)))).
RS 2 seq AGGAAACUUAUAGCGCCUGAACAAAGCGCAUACACGAUUGUAGAGGCAUGUAUAAUCAGAUACAUGCUGAAUGAGUGUUAUGACCUUUGUUGACGAGGAGGAUAGUUAUCGAAUUUUCGGCGGAUGCUAUCCCGGAUGUGGCCCAUUCGAAGUUCAAUGUUUAAAGCAUAUAGGUGACUGUAUGUCCAAAGACGUUGAAAUAGCCAUAA
RS 2 dot ……………(((((((((((..(((((((..((((…(((((((((……)))))))))..)))))))).)))..)))))))..).))).((((((.((((…………))))))))))((((((…..))))))…((((((((((…((((((((….))))))))….))))))))))……….
RS 3 seq AAAUAAAAUAAAGCGCCUGGACAAAUAAUUAAAAUGUUAACCAUUUAGUAUUAAUUAAGAGAAUGCUAAUAGACAUAUUAAUUAUAUUGUAGACGAGGAGAAUAGUUAUCGAUAUAAUCGGCGGAUGCUAUUCCGGAUGUGGCACAUUCGUUAGCUUAUUAUUUAAAACAUAUAGGUAACUAGAUGUACAAAUAUAAUAAGAACGCCAAAU
RS 3 dot ……………(((.(((((((((((((.(((((……((((((((………))))))))..))))).)))))))).))))…).))).((((((.((((………….))))))))))(((((((…)))))))….((((((((…..((((.(((….))).))))……))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table