Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106299 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA106299
Gene: SYNGR1
MFE: -35.086
ENS: 0.920
Length: 87.
Predicted Ligands:
zmp-ztp - 6/20
glycine - 4/20
GMP - 3/20
 RS: URS0000C69D3A_321267
MFE: -22.438
Ligand: glycine
Species: Shimia marina Glycine riboswitch
 RS: URS0000D789D8_1993
MFE: -31.006
Ligand: zmp-ztp
Species: Actinomadura madurae ZMP/ZTP riboswitch
 RS: URS0000C800FC_525246
MFE: -41.483
Ligand: zmp-ztp
Species: Actinomyces urogenitalis DSM 15434 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106299 URS0000C69D3A_321267 URS0000D789D8_1993 URS0000C800FC_525246
Length 87. 87. 87. 87.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.920 - - -
MFE -35.086 -22.438 -31.006 -41.483
Ligands - glycine zmp-ztp zmp-ztp
Gene SYNGR1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 0. 5.006
Length SE - 0. 0. 0.
Lev Distance - 29. 31. 30.
UBS 8. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 1. 2. 1. 0.
H 4. 3. 4. 3.
BL 2. 3. 2. 1.
BR 2. 2. 2. 2.
UN 0.057 0.103 0.057 0.138

Sequences

Field Description
UTR seq + 25 cgcgcacgcgcacgggccggcggcgcgcgccgagcggggggcaccgcgcgggugcagccacgATGTTGACCTTAGAGTTTGGGATTC
UTR dot + 25 (((((.(((((….))..))))))))((((..(((.((….)).))).))))((((……)))).(((……..)))….
RS 1 seq UAAGGUGAAUCGGGAGAACUGGAUUUUCCAGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCCAACGGGACCGACCACCGACA
RS 1 dot …((.(((((.((….)).))))).)).(.(((…((((…(((…)))…))))..))))..(((………)))…
RS 2 seq UGGCUGGCACGCGACUGGCGCAGUCAAGGUGGAGACGACCACCGGGGAGCGAAAGUAGUCCGCACACCGCGCGCCUGGGUGUACGGG
RS 2 dot ((((((…(((…..))))))))).(((((……)))))(.(((((….))..))).)…(((.((((….)))).))).
RS 3 seq CCACCCGGUCGCAACUGGCGAGGGUGGGGUACCACCGGGGAGCGACCACGAUCCACCGAAGGGGCGUCGCCCGCCUGGGCGCCCUAC
RS 3 dot ((((((..((((…..))))))))))……..((((((.((….)).))).)))..(((((…((((….)))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table