Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106348 Similarity: 0.962 Similarity: 0.960 Similarity: 0.959
UTR: 5HSAA106348
Gene: SYNJ2BP
MFE: -44.577
ENS: 0.775
Length: 152.
Predicted Ligands:
FMN - 8/20
cobalamin - 6/20
zmp-ztp - 3/20
 RS: URS0002331AB9_463191
MFE: -65.288
Ligand: cobalamin
Species: Streptomyces sviceus ATCC 29083 Cobalamin riboswitch
 RS: URS000232F31F_56956
MFE: -64.820
Ligand: cobalamin
Species: Thermus brockianus Cobalamin riboswitch
 RS: URS0000D95D73_1798804
MFE: -57.083
Ligand: FMN
Species: Rhizobium sp. 58 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106348 URS0002331AB9_463191 URS000232F31F_56956 URS0000D95D73_1798804
Length 152. 153. 154. 151.
Similarity - 0.962 0.960 0.959
Ensemble Norm 0.775 - - -
MFE -44.577 -65.288 -64.820 -57.083
Ligands - cobalamin cobalamin FMN
Gene SYNJ2BP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7.003 14.003
Length SE - 1. 4. 1.
Lev Distance - 49. 45. 47.
UBS 12. 12. 13. 13.
BS 0. 0. 0. 0.
ILL 5. 4. 6. 3.
ILR 3. 2. 5. 3.
H 3. 3. 3. 3.
BL 2. 3. 2. 5.
BR 4. 4. 3. 4.
UN 0.086 0.098 0.032 0.139

Sequences

Field Description
UTR seq + 25 cuuuuccgggucucgaggcugcugaaaccgaaaccgcugugcugugggcgcagcgccgagauugauucaccuucaccugugcugcacuccagcugacccaaguaggaagccagacgagcuguaaaacATGAACGGAAGAGTGGATTATTTGG
UTR dot + 25 ……..(((.((.((….)))).)))…..(((((((((…)))))))))(((((..((((((((((((…(((..(((((((..(((..((……)).)))…..))).))))..)))……)))).)))))))))))))
RS 1 seq AAGUUGACGGGUCUCGAAGGCCCGUGGUGGACUGCCGGAGCCAUAUACGGCGGCAGGAGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGACACCCCCGGGAGCCAGGAACUCUCGCCGCCGGACUCGUCGAACC
RS 1 dot ….(.((((((((…)))))))).)….(((((…(((……))))))))..((.((..(((((((((.((((((….(((((………..(((((….))))))))))))).)))….)))).)))))..)).))…..
RS 2 seq GCGGCUGGGGUGCCCCAAGGCCCGGAUGUCUUGGGGCAGCAAAGGGGGAAGACCGGUGAAAGUCCGGCGCUGUGCCGCAACGGUAACCGGCCCGCGCAUCAAGCCCUUCGUCAUGGUCGGAAGCCCGAAUACCCGCCCCGGCGCGCGCCUCACC
RS 2 dot ….((..(.(((((((((((……))))))))))).)..)).((…..))(((((……(((((.((((((….((((..(((((((..(((…((…..)).)))..)))..))).)..))))…..))))))))))))))))
RS 3 seq GCACGUUCUCAGGGCGGGGUGAAACUCCCCACCGGCGGUAGCGGGAGAAGUCCCGAAGCCCGCGAGCGCUCUCUGUCGCAAGCUGGAGAGGUCAGCAGAUCCGGUCAAAUUCCGGAGCCGACGGUUAAAGUCCGGAUGGAAGAGAGCAAGC
RS 3 dot …………((.((((…….)))).)).(((((..(((((….)))))..))).))….(((((((.((.((..(((((((.(((.((…(((((…….))))))).)))..))….))))).)))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table