Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106394 Similarity: 0.976 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA106394
Gene: SYPL1
MFE: -44.579
ENS: 0.930
Length: 107.
Predicted Ligands:
TPP - 8/20
SAM - 4/20
glycine - 4/20
 RS: URS0000C08833_586416
MFE: -27.529
Ligand: SAM
Species: Terribacillus aidingensis SAM riboswitch (S box leader)
 RS: URS0000D69ECD_12908
MFE: -38.010
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D7BC52_235985
MFE: -38.920
Ligand: methionine
Species: Streptacidiphilus jiangxiensis S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106394 URS0000C08833_586416 URS0000D69ECD_12908 URS0000D7BC52_235985
Length 107. 106. 106. 106.
Similarity - 0.976 0.976 0.975
Ensemble Norm 0.930 - - -
MFE -44.579 -27.529 -38.010 -38.920
Ligands - SAM GMP methionine
Gene SYPL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 3. 11.015
Length SE - 1. 1. 1.
Lev Distance - 29. 30. 28.
UBS 9. 8. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 4.
ILR 3. 2. 3. 4.
H 2. 3. 2. 2.
BL 4. 4. 3. 3.
BR 3. 2. 4. 4.
UN 0.159 0.142 0.142 0.038

Sequences

Field Description
UTR seq + 25 gagcgcacgcguacacgcgugcgcaggggaagaccgagugccaggggcugaaccgcagggaagggggcgcggcgcacgcaguATGTCCGGCTTCCAGATCAACCTCA
UTR dot + 25 ..(((((((((….)))))))))…(((((.((((.(((…(.((((..((.(…….).))..)))).)..))).)…..))))))))…………
RS 1 seq AACUUAUCUAGAGUCAGGGUAGGAACUGGUCCAGCGACCCUGCAGCAACCGCUUGUUUGAAGUAAGGUGCUAAGUCCAGCAGACUGACACGUCUGAGAGAUGAGAG
RS 1 dot ..(((((((…….)))))))..((((.(.(((.(((.(((..(((……..)))..))).))))))..).))))(((((……)))))………..
RS 2 seq GAGUGAAGGGGACGCGAAGAUCCUCUGGCGGUGACUUCGGUCGCCUCCCUGGACGUCGAUCCAGGCCGCCUGAGGGGAGCGAGUGGCGAGACCGACCCGGACAUGG
RS 2 dot ……(((((((…..).))))))((((((..(.(((.(((.((((((((..(((……)))..))…))))))))).))).)..)))).))………
RS 3 seq GGUCAUGAGCGUCAGCGUCAAGCCCUGGCUUGCUGACCGGCAACCCUCCCCACGCGGCGGGGUGCCCCAGGUGAGGACCGGACCGAACUGUCGGUAAGCGCGAUGC
RS 3 dot (((..(((((….)).))).)))(..(((((((((((((…((.(((.(((..((.((….))))..))).)))..)).)))….))))))))))..)….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table