Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106826 Similarity: 0.982 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA106826
Gene: TANK
MFE: -20.678
ENS: 0.937
Length: 93.
Predicted Ligands:
TPP - 6/20
SAM - 4/20
glycine - 3/20
 RS: URS0000C32D33_1703392
MFE: -24.966
Ligand: Ni/Co
Species: Dehalococcoidia bacterium DG_18 NiCo riboswitch
 RS: URS0000AB5706_12908
MFE: -17.410
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
 RS: URS0000C0D742_1897620
MFE: -25.125
Ligand: TPP
Species: Marinobacter sp. X15-166B TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106826 URS0000C32D33_1703392 URS0000AB5706_12908 URS0000C0D742_1897620
Length 93. 92. 93. 93.
Similarity - 0.982 0.978 0.978
Ensemble Norm 0.937 - - -
MFE -20.678 -24.966 -17.410 -25.125
Ligands - Ni/Co SAM TPP
Gene TANK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.002 10.004 8.012
Length SE - 1. 0. 0.
Lev Distance - 18. 25. 26.
UBS 9. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 2.
ILR 3. 2. 1. 4.
H 2. 2. 2. 1.
BL 4. 1. 4. 2.
BR 4. 4. 3. 3.
UN 0.151 0.109 0.215 0.043

Sequences

Field Description
UTR seq + 25 ccggcgaccugaggggagagggaacgcagcugaaagcgugaacuguugaugcuacaggacgaagaggaATGGATAAAAACATTGGCGAGCAAC
UTR dot + 25 .(..((.((((((.(..((.((.((((……..))))…)).))..).)).)))).))..)…((((……..))))……….
RS 1 seq AAAUUAGAGUUGGAGCAGGCGACCUUAAUGACGUUUUAAGGUGCAGCCGGGCUGGGCUUCUGGCAACGGUACUUUGAGACCGCGGGACUAUG
RS 1 dot …((((((((..(((.(((((((((((…….))))))).).)))..))).)))).))))(..((((……..))))..)…….
RS 2 seq AGUAAGCAUAUUGAGAAGGUUAAGACCUCAGCAACCUGGAAGACUAUCCAAGGUGCUUGAAGAUGUGGCAGAAAUGCAACUAAAUAGUCAGAA
RS 2 dot ..(((((((.(((.((.((((….((……….))..)))).))))).)))))))…..((.(((….))).))………….
RS 3 seq CGGGACUCAACGGGGUGUCCUUCAGGGGCUGAGACCAUACCCGCGGAACCUGAUCCUGAUCAUGCUGGCGAAGGAAUUGAGUGCACACCCUUA
RS 3 dot .((((((((((((.(((((..(((((..(((.(……..).)))..)))))….)).))).)))………))))))…..)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table