Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA106934 Similarity: 0.970 Similarity: 0.968 Similarity: 0.966
UTR: 5HSAA106934
Gene: TARDBP
MFE: -37.495
ENS: 1.
Length: 122.
Predicted Ligands:
FMN - 5/20
TPP - 4/20
glycine - 3/20
 RS: URS0000ABC007_573060
MFE: -45.638
Ligand: TPP
Species: Acidovorax delafieldii 2AN TPP riboswitch (THI element)
 RS: URS0000C817EF_12908
MFE: -20.796
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C643CB_1736576
MFE: -45.456
Ligand: glycine
Species: Pseudoxanthomonas sp. Root65 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA106934 URS0000ABC007_573060 URS0000C817EF_12908 URS0000C643CB_1736576
Length 122. 121. 122. 122.
Similarity - 0.970 0.968 0.966
Ensemble Norm 1. - - -
MFE -37.495 -45.638 -20.796 -45.456
Ligands - TPP glutamine glycine
Gene TARDBP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 2.010 6.002
Length SE - 1. 0. 0.
Lev Distance - 39. 42. 43.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 1. 0. 1.
H 6. 5. 5. 4.
BL 3. 3. 3. 3.
BR 3. 3. 3. 3.
UN 0.148 0.174 0.246 0.197

Sequences

Field Description
UTR seq + 25 gcgcuuugaaagugcgcgagcuccgaccgagaccugggccggcgguuggucggccgaaaccaucugcuacguuacguggggggaggaaaaguaaaagATGTCTGAATATATTCGGGTAACCG
UTR dot + 25 ((((………))))…(((…..)))…(.(((((((…..))))))).)..((.(((.((((…..)))).))).))……….(((((……)))))(((….)))
RS 1 seq GCGCCUGCUCCGGGGUGUGCUGAUGCACUGAGAUGCGGGGGGCCUGACAUGCAGGCCCAGCCGCGAACCCGACGAACUUGAUCCGGUUCAUACCGGCGGAAGAAGAGCCGACCCCUCCAUG
RS 1 dot ((.((……)).))((((….))))……((((.(((((((…..)))))))..))))(((((.((((….)).)).)))))….((((………))))………..
RS 2 seq UUCGUUCAUCUUAUAUUUUAUAUAAGACGGAAGUAGGAAACCUGAAAACCUCUUUCUAUUCAGAAAGGCAAGCAAGUACCCGCAAGGGGAACGAGACCGAAAGUUUACCGAAGGAACGCUAU
RS 2 dot ..(.(((.((((((((…)))))))).))).)((((…))))……(((((((….)))))))…….((.(((…..))).))……….((((…….))))…..
RS 3 seq CAACGACACUCUGGAGAGACCGGCCGCCCUCGCGGCAGCGCCGGCGCCGAAGGGGCACGAAGCACGCGACCUCCUCGUCGGCGCGCUUCCAAACUCUCAGGCAAAAGGACAGAGGGGCAUCC
RS 3 dot ……….((((…..))))..(((((..((((.((….))))))..)))))..(((((.((((((……)))).)).)))))….(((((.(………).)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table