Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107133 Similarity: 0.968 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA107133
Gene: TBC1D16
MFE: -79.676
ENS: 0.864
Length: 141.
Predicted Ligands:
cobalamin - 9/20
FMN - 6/20
SAM - 3/20
 RS: URS000233049E_926569
MFE: -57.742
Ligand: cobalamin
Species: Anaerolinea thermophila UNI-1 Cobalamin riboswitch
 RS: URS000231EEC3_1305826
MFE: -64.396
Ligand: cobalamin
Species: Streptomyces sp. Amel2xC10 Cobalamin riboswitch
 RS: URS000231635A_1739111
MFE: -65.077
Ligand: cobalamin
Species: Streptomyces sp. DSM 15324 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107133 URS000233049E_926569 URS000231EEC3_1305826 URS000231635A_1739111
Length 141. 142. 142. 142.
Similarity - 0.968 0.967 0.967
Ensemble Norm 0.864 - - -
MFE -79.676 -57.742 -64.396 -65.077
Ligands - cobalamin cobalamin cobalamin
Gene TBC1D16 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 9. 2.003
Length SE - 1. 1. 1.
Lev Distance - 39. 37. 42.
UBS 13. 13. 14. 12.
BS 0. 0. 0. 0.
ILL 1. 0. 3. 1.
ILR 4. 5. 4. 4.
H 1. 1. 1. 1.
BL 7. 8. 7. 8.
BR 6. 7. 8. 6.
UN 0.057 0.063 0.035 0.113

Sequences

Field Description
UTR seq + 25 gacgguggcggcucucggagccggcgcgaauccggcccccgcagcgggacccgggcaggucuugacgagcccugcccgggccgacgcaugcggaggauggaaacacuugcccggcaATGAAGCAGGTCGCCCCCGATAAGA
UTR dot + 25 ..(((.(((((((((((..(((((.((((.((((.((.((((((((((.((((((((((.(((…))).))))))))))))..))).))))).)).))))…..)))))))))..))).)..))))))).)))……
RS 1 seq CAACAAAACACCCCCUCAGGUGCCCUGCUCCCGGAUGGGCGGGCAUAAUGGCGAAGCCGGUGCAAGUCCGGCACUGUCGCGCAACUGUGAUCCACACGCCGGUGUGGUCAGUCAGGUCGACCGCCUGAGGUGGCGUUUCUCA
RS 1 dot …..((((.((.(((((((((.((((((.(((.((.((((((((((.((((((.(((((…….)))))….)))).))..)))).)))….))).)).)))..)).))))…..))))))))).)).))))….
RS 2 seq GCCCUUCGGGGCCCGUGGUGGACUGCCGGGGCCAGCUACGGCGGCAGAAGAGGAAGCCGGUGCGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGGAACCCCCGGGAGCCAGGAACUCUCACCGCCGGUCUCGUCGAA
RS 2 dot …(..(((((((.((((((((((.((((((((.(((.(((.(((((..(.((..(((.((((…….))))))).)).)..))))).))).))).))…)))))).))……..)).)))))).)))))))..)..
RS 3 seq GCCCUUCCGGGGGCGUGGUGGACUGCCGGGGCCAUGUACGGCGGCAGAAGAGGAAGCCGGUGAGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGGUAGCCCCGGGAGCCAGGAACUCUCGCCGCCGGUCUCGUCGAA
RS 3 dot ……((((.((((.(((((.((.(((((((.((.(((((.(((((….(((.(((((…….)))))….)))…..))))).))…))).)).))))))).)))))…..)).)))).))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table