Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107352 Similarity: 0.974 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA107352
Gene: TBC1D8B
MFE: -24.023
ENS: 0.873
Length: 114.
Predicted Ligands:
TPP - 9/20
SAM - 6/20
preQ_1 - 3/20
 RS: URS0000AB5A02_342616
MFE: -18.448
Ligand: preQ_1
Species: Streptococcus agalactiae COH1 preQ1-II (pre queuosine) riboswitch
 RS: URS0000ABD582_205921
MFE: -18.448
Ligand: preQ_1
Species: Streptococcus agalactiae A909 preQ1-II (pre queuosine) riboswitch
 RS: URS0000C7A726_29332
MFE: -35.651
Ligand: TPP
Species: Bacillus aminovorans TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107352 URS0000AB5A02_342616 URS0000ABD582_205921 URS0000C7A726_29332
Length 114. 114. 114. 115.
Similarity - 0.974 0.974 0.974
Ensemble Norm 0.873 - - -
MFE -24.023 -18.448 -18.448 -35.651
Ligands - preQ_1 preQ_1 TPP
Gene TBC1D8B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 12. 13.003
Length SE - 0. 0. 1.
Lev Distance - 31. 31. 30.
UBS 6. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 2.
ILR 0. 1. 1. 2.
H 4. 3. 3. 3.
BL 2. 1. 1. 2.
BR 2. 4. 4. 2.
UN 0.246 0.254 0.254 0.191

Sequences

Field Description
UTR seq + 25 aaaaguggauguuuauuaugagugaguagccacugaaaucauaucucuugcagaaauaugguaauauucgcuaugaagauauacauaguATGTGGCTGAAGCCTGAGGAAGTGC
UTR dot + 25 …(((((.((((((((…)))))))).)))))…(((((((.(((…))).)))))))…….((((((……..))))))….(((….)))………..
RS 1 seq UGUGAUAUACUUAGUAAGUUGUUUUACACAACCCUUGAUGCUUAGUUCCCUUUCAUCAAGCAUAUUACAAACGUUAGAAGUGUUAACUGUCUAAACGUUAAAGGAGAAAUUAUG
RS 1 dot (((((.((((((…)))).)).)))))…..(((((((…((….))..)))))))………((((((((((((….))).))))).))))……………
RS 2 seq UGUGAUAUACUUAGUAAGUUGUUUUACACAACCCUUGAUGCUUAGUUCCCUUUCAUCAAGCAUAUUACAAACGUUAGAAGUGUUAACUAUCUAAACGUUAAAGGAGAAAUUAUG
RS 2 dot (((((.((((((…)))).)).)))))…..(((((((…((….))..)))))))………((((((((((((….))).))))).))))……………
RS 3 seq GAUAUCUGCUGGGGGUGUCCGUUAGCCGGACUGAGAGAAGAGCGCGAAUAAGGCUCUUUGACCCUUCGAACCUGAUCUGGUUGAUACCAGCGUAGGGAAGUAGGGAGAGACGGCU
RS 3 dot ….((((((((.((…)).))))).)))……(((((((.(……))))))))..((((…..((((..(((((….)))))..))))…..))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table