Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107386 Similarity: 0.958 Similarity: 0.957 Similarity: 0.957
UTR: 5HSAA107386
Gene: TBCCD1
MFE: -59.207
ENS: 0.857
Length: 154.
Predicted Ligands:
FMN - 14/20
cobalamin - 2/20
SAM - 1/20
 RS: URS0000C6FB23_1218173
MFE: -40.397
Ligand: FMN
Species: Bacillus alcalophilus ATCC 27647 = CGMCC 1.3604 FMN riboswitch (RFN element)
 RS: URS0000D870B8_185642
MFE: -63.927
Ligand: cobalamin
Species: Mycobacterium parmense Cobalamin riboswitch
 RS: URS0000ABCEC9_519
MFE: -66.445
Ligand: FMN
Species: Bordetella parapertussis FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107386 URS0000C6FB23_1218173 URS0000D870B8_185642 URS0000ABCEC9_519
Length 154. 153. 154. 154.
Similarity - 0.958 0.957 0.957
Ensemble Norm 0.857 - - -
MFE -59.207 -40.397 -63.927 -66.445
Ligands - FMN cobalamin FMN
Gene TBCCD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 12.001 2.001
Length SE - 1. 0. 0.
Lev Distance - 52. 52. 57.
UBS 10. 12. 9. 10.
BS 1. 0. 3. 1.
ILL 1. 1. 2. 1.
ILR 1. 1. 2. 1.
H 5. 6. 3. 5.
BL 4. 5. 4. 3.
BR 4. 4. 3. 3.
UN 0.130 0.144 0.156 0.104

Sequences

Field Description
UTR seq + 25 aggagggugaggggcgggcccagcgagcggacgccgggcgcggcggcgcgcggagaagugcggcggagcggcgccugcauuagcagguaugcaaagaagccuuuucacccugauguccuuagagauaauATGACAGACCGACTTAAGTTCGGAT
UTR dot + 25 …(((((((((((((.((((.(((……))).)))).)).((.(((((……))))).))..(((..((((((….)))))).)))……..)))))))))))..((((.(((….)))…))))..((((…….))))..
RS 1 seq AUAAUCCUUCGGGGCGGGGUGCAAUUCCCCACCGGCGGUGAUGAGGGUUUACCCUCUUAGUCCGUGACCCGCGUAUUCGUUUUUUAUUAAUAAGCGGCUGACCUAGUGUAAGUCUAGGACCGACAGUAAUAGUCUGGAUGGGAGAAGGAGAGC
RS 1 dot …..((.((((…((((…….)))).)))).))(((.(((((….))))))))(((…)))((((.((((.((…..)).)))).))))….(((((…….))))).(((.(((…….)))..)))…………
RS 2 seq AGAGGGAACCCGGUGUGAAUCCGGGACUGUCCCGCAGCGGUAUCCGGGAACGACCGCCGUCAUCGGCACUGGGAACAGCGAAGCCCGCUGAUCCCGGGAAGCGACGGCCAGUAGAUGCACCGAAAGCGGUGCGCGCCCGGGAGUCCGAAGACCU
RS 2 dot …(((..(((((.(((..(((((((((((……))))).))))))….((.((((((..(..(.((((((.(((((…..))))).)))))))..).))))))..))…(((((((….)))))))))))))))..)))……..
RS 3 seq GUACGUCUUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAUGCCACGCAAUGUGGCGAGCCCGCGAGCGCCCUGCGUUGGCAACAGCGCAGGGGUCAGCAGACCUGGUGAGAUGCCAGGGCCGACGGUCAUAGUCCGGAUGAGAGAAGAUGUGC
RS 3 dot ((((((((((..((.((((…….)))).))…(((.((((((…..)))))).))).((..((.((((((((((….))))))))))))..))…((((((…..)))))).(((((…….))).))……))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table