Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107419 Similarity: 0.981 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA107419
Gene: TBK1
MFE: -26.745
ENS: 0.923
Length: 87.
Predicted Ligands:
GMP - 9/20
cyclic-di-GMP - 5/20
glycine - 4/20
 RS: URS0000D66818_12908
MFE: -25.139
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GCG riboswitch
 RS: URS0000D6D252_12908
MFE: -25.338
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000D65C34_12908
MFE: -42.
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107419 URS0000D66818_12908 URS0000D6D252_12908 URS0000D65C34_12908
Length 87. 87. 88. 87.
Similarity - 0.981 0.981 0.981
Ensemble Norm 0.923 - - -
MFE -26.745 -25.139 -25.338 -42.
Ligands - GMP GMP GMP
Gene TBK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 1. 1.006
Length SE - 0. 1. 0.
Lev Distance - 24. 24. 26.
UBS 6. 7. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 1. 2. 1. 0.
BR 1. 0. 1. 1.
UN 0.126 0.115 0.148 0.046

Sequences

Field Description
UTR seq + 25 gccggcgguggcgcggcggagacccggcugguauaacaagaggauugccugauccagccaagATGCAGAGCACTTCTAATCATCTGT
UTR dot + 25 ((((((….)).))))……..((((((…..(((…..)))……)))))).(((((.(((…..)))…)))))..
RS 1 seq UCCAAGACGGGAAGCAAAGACGCGUGAUCCACUCCGGUCGCCGAACCGGAUCACGUCGAGCAGUGGCGAGCCCGGUCCCGUGUGAGA
RS 1 dot (((……)))……….((((((((….(((…)))….))))))))((..(((.(((.((……))))))))..))
RS 2 seq CAUCCUGCUGGAAGCGACAAACCGCGAUUCGUGUUGAACCGGUCACCUAGAAUCGCGGGAGCAAGUGGUGAGACCGACCAGAAUUCUU
RS 2 dot ..(((….)))………(((((((((..(.(((…..))).)..)))))))))(((….((((…….))))…)))..
RS 3 seq CGCGGAACGGGGGUUCCGCCAGCACACUGGUGGAUACGGUCGCCAGUCCGGUGUGCUGGGCCAAUGGCGAGACCGACCCGGGCUACG
RS 3 dot .(((((((….)))))))((((((((((((((………)))..)))))))))))((((…((((….)).))..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table