Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107498 Similarity: 0.948 Similarity: 0.948 Similarity: 0.948
UTR: 5HSAA107498
Gene: TBR1
MFE: -39.326
ENS: 0.781
Length: 188.
Predicted Ligands:
cobalamin - 14/20
lysine - 4/20
FMN - 1/20
 RS: URS0000C88D74_915437
MFE: -78.369
Ligand: lysine
Species: Saccharibacillus sacchari DSM 19268 Lysine riboswitch
 RS: URS000232BBD8_1415775
MFE: -28.718
Ligand: cobalamin
Species: Clostridium baratii str. Sullivan Cobalamin riboswitch
 RS: URS0002327710_1618673
MFE: -73.852
Ligand: FMN
Species: Candidatus Kaiserbacteria bacterium GW2011_GWB1_50_17 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107498 URS0000C88D74_915437 URS000232BBD8_1415775 URS0002327710_1618673
Length 188. 187. 187. 188.
Similarity - 0.948 0.948 0.948
Ensemble Norm 0.781 - - -
MFE -39.326 -78.369 -28.718 -73.852
Ligands - lysine cobalamin FMN
Gene TBR1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 5. 10.001
Length SE - 1. 1. 0.
Lev Distance - 65. 66. 66.
UBS 11. 12. 12. 11.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 4. 4. 4. 3.
H 5. 6. 5. 5.
BL 1. 3. 1. 3.
BR 1. 1. 3. 3.
UN 0.181 0.166 0.198 0.144

Sequences

Field Description
UTR seq + 25 acggcaccuuuccuaaauaccaagccggugggaaaaagcuuucuauuuguuuucgucgcuggucacccgggccaccuuugagauuacacaacugaaaauagaucacaacccuuuugcaaaaggauuucgggauaauuaugacacgaucuacaccggcugugacATGCAGCTGGAGCACTGCCTTTCTC
UTR dot + 25 ..(((…((((((….(((…..)))))))))..))).((((((((((((((..(.(((((…..))))).)..)))))..)))……..))))))…….(((((….)))))…(((…………..)))……((((((((…..))))))))……………
RS 1 seq UGAUGAGGUAGAGGUUGCGGUGGCGAUCAGUACACCGGAGGAGGCGCAGCAGAGCGCCGAUGAUCCCGGCCGGAAAGGCGCACCCGCCGAAGCACGGCGUUCUCUGAACUGAACCCCGUGCUGGGACCGUCUCCGAAAGGAACGGAACUGUCACCUGCCGUAAGGCGGGUGUUGAGCUAUCUUCACG
RS 1 dot …….(((..((((((….))))))..))).((((.((((((((……)))))…..)))…))))…((((….))))..(((((((.((((……..)))).)))))))((..((((.(((….)))))))..))..((((((((….))))))))…………….
RS 2 seq AAAUAUAUAUAAAUAAUAGGUUUCUAAAAUUUAUAUUUUAGUAAAAGGGAAAGUGGUUAGAAUCCACUACAGCCCCCGCUACUGUAAUAGCAGAUGAAUCUCAAUGUAUCCACUGGUUUAUAUACUGGGAAGGAAGAGAGGAGGAUGAAGCUUAAGUCAGGAUACCUACCUAUUAUUAAUUAAAUCC
RS 2 dot ……((((((((..(((….)))..))))))))..((((….(((..(((((…….)))))….)))..))))((((….))))…..(((((.(((((((…))…))))).)))))……..((((((((……………)).))).)))…………….
RS 3 seq AGGUUCCUUCGGGGUAGGGUGAUCUGCCGGGUGGCGGAAAAUCCCGAUCGGUGGUAAAGCUCUUUGUUUGCGUGUCAUACGCGGACAAAGAAGCGAGUCCACGAUCCCGCCCUUUGUUCGCAAAGAGCGGGAACGACUGCGGUUAGAUUCCGCGACCGACCGUAUAGUCGGGAUAAAAGAAGGGGUGG
RS 3 dot …..((.(((((((…….((((((….))))))..)))))))..))(((….((((((((((((((((…)))))))))))))).))….)))((.((((((.(((((….))))).)))))).))…((((…….))))..(((((……)))))……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table