Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107608 Similarity: 0.950 Similarity: 0.949 Similarity: 0.946
UTR: 5HSAA107608
Gene: TCEAL1
MFE: -47.154
ENS: 0.767
Length: 199.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231F31F_1905359
MFE: -42.601
Ligand: cobalamin
Species: marine bacterium AO1-C Cobalamin riboswitch
 RS: URS000231E0C3_1851148
MFE: -57.402
Ligand: cobalamin
Species: Phycisphaerae bacterium SM-Chi-D1 Cobalamin riboswitch
 RS: URS000232C20A_319224
MFE: -40.267
Ligand: cobalamin
Species: Shewanella putrefaciens CN-32 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107608 URS000231F31F_1905359 URS000231E0C3_1851148 URS000232C20A_319224
Length 199. 199. 198. 200.
Similarity - 0.950 0.949 0.946
Ensemble Norm 0.767 - - -
MFE -47.154 -42.601 -57.402 -40.267
Ligands - cobalamin cobalamin cobalamin
Gene TCEAL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.015 15. 21.015
Length SE - 0. 1. 1.
Lev Distance - 64. 59. 60.
UBS 12. 11. 10. 13.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 6.
ILR 4. 3. 1. 7.
H 4. 3. 5. 3.
BL 3. 4. 3. 2.
BR 2. 3. 2. 2.
UN 0.231 0.111 0.212 0.110

Sequences

Field Description
UTR seq + 25 aggaagaggcaauacuacccgagacuagaugcggaccgucucuggcaaccaggaaaaggcaaauacaaagagaggucugcuggucacagcggggcaccucgaggagaggacgacuaggagcacacggcccggaaagguccagaauaacugugcuugaagaagaaaauucccaacATGGACAAACCACGCAAAGAAAATG
UTR dot + 25 ……………..((((.(((((…(((((((.(((((…………………….)))))))))))))))))….))))…((((…..)))).(..((..((((((((((.((…..)).)).)……)))))))..))..)…..(((……)))………………..
RS 1 seq UACUUUGUAUUUAGUUCUGGUAACCAAACCCUUUUCCGGGAGCGGUUUUAAUAGGGAAUCUCGUGAAAAUCGAGAGCUGUCCCCGCAACUGUAAGCAAGCCAGAUUUCUUACCAACCCCUGCCACUGUAAGCCUUGUGUUCACGGGAAGGCGGUAAGAAAGAAGCAAGCCAGGAGACCUGCCAGAAAGCCUCAAAUAAC
RS 1 dot ……………((((((……………((((.(((((…………(((((…….)))))))))).))))………….))))))(((((((((…….(((.((((.(((…..))).))))…))))))))))))((.((….((((…))))…….)).))…….
RS 2 seq AAUUUAAAAAUAUGCCCGUGUCCGUAUUCCGGUUAAAAGGGAAUGCAGUGAAAAUCUGCAACGGUCGCGCCGCUGUAUGCGUCUGGAUAACAAGAAUAAUCCAGAAACAGGCAAUAUGCCACUGUGACAGCUAAUGUCGCGGGAAGGCGCCUGUUUGCAAACGCAAGUCAGAAGACCUGCACUGGUAUAGAUCUUUAG
RS 2 dot …………….((((.((((………………(((((…….))))))))).)))).(((…..)))(((((((……….)))))))(((((((…..(((.((((((((…..))))))))…))))))))))…….(((.(((….))).)))………………
RS 3 seq GUUGUUUUCAUUCUCAAUGGCGUUGUGAACAAAGUGCAUAUCAACCCAAACAUAAUAGGGAAUCGGGGCGCUGCUUGUCAGUCAGCCCGAACUGUACCCGCAACUGUGAGUAGUAAAAGAAGAACCUAGAACCUAGAACCUAGAACCUAGAACCUUCUUUCCCUACAAGUCAGGAGACCUGCCUAUUUCUGUUAUCGCUG
RS 3 dot (((((…………(((.(((((..(((((((((…….(((……….)))…….)))))..))))..).)))))))……….)))))…..((((..(((((((…((((…((((…))))…))))…)))))))..)))).((.((((…)))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table