Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA107612 Similarity: 0.952 Similarity: 0.948 Similarity: 0.947
UTR: 5HSAA107612
Gene: TCEAL1_0
MFE: -44.452
ENS: 0.825
Length: 160.
Predicted Ligands:
glucosamine - 14/20
cobalamin - 2/20
molybdenum - 1/20
 RS: URS0000C691D8_1640515
MFE: -71.415
Ligand: glucosamine
Species: Armatimonadetes bacterium CSP1-3 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C7AEBB_320778
MFE: -45.898
Ligand: molybdenum
Species: Photobacterium ganghwense Moco (molybdenum cofactor) riboswitch
 RS: URS0000BE21BD_1263002
MFE: -55.786
Ligand: glucosamine
Species: Firmicutes bacterium CAG:124 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA107612 URS0000C691D8_1640515 URS0000C7AEBB_320778 URS0000BE21BD_1263002
Length 160. 161. 159. 160.
Similarity - 0.952 0.948 0.947
Ensemble Norm 0.825 - - -
MFE -44.452 -71.415 -45.898 -55.786
Ligands - glucosamine molybdenum glucosamine
Gene TCEAL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 22.033 13.015 36.024
Length SE - 1. 1. 0.
Lev Distance - 56. 64. 59.
UBS 6. 9. 9. 10.
BS 4. 3. 3. 0.
ILL 1. 0. 2. 1.
ILR 1. 4. 1. 2.
H 4. 4. 4. 5.
BL 4. 5. 3. 3.
BR 2. 1. 3. 3.
UN 0.250 0.068 0.126 0.094

Sequences

Field Description
UTR seq + 25 cccugucuugcgucugugugcaggucugcuggucacagcggggcaccucgaggagaggacgacuaggagcacacggcccggaaagguccaggucagggaagggaauaacugugcuugaagaagaaaauucccaacATGGACAAACCACGCAAAGAAAATG
UTR dot + 25 (((((.((((((.((((((((.(.(((((((….))))))).).((((…..))))……….))))))))..))……..)))).)))))..((((((..((………..))…))))))….(((…..)))………….
RS 1 seq AAUCGUGCCGCAGCGCCUGAACCGGACGCGACCAGCGUCCGGUUGACGAGGGAGGGGACCUCGAAGUAUUCGGCGGGUGACCCUAGGCCUGGUCCGGGCCUGCACGGCCUCCACUCCAUAACGCCACGGAGACCGGAGGAAAGGGGAGGCGACAAACUCCG
RS 1 dot ..((((…((((.(((((((((((((((…..))))))))))(((.(((.((((.((((((((…))))..))))..))))…))).))))))))))))))))(((((.((((……….))))…)))))…..((((……..)))).
RS 2 seq CAAUUGCCAUAACUCCGAGCUUGCUGCACUAAGUUCCUGAUCUUGGCCAAGGGUCUGUGACGGGGAUAGGUGAGUUAAGCCAGUGACAGGUUGUCACCAGGGUCGAUAAAGAAAUGCAUCGGCCUCCCAUAUUUGGAAAGGUGUUCCGUGGCGAAACAA
RS 2 dot …((((((((((.((..(((((((.((((..(((((((.((..((((…))))…))))))))).))))))).))))..((((((…))))))..((((((((……….)))))))).(((….)))…)).)))..)))))))…..
RS 3 seq UCGCCAUCACAAGCGCCAUGCGCCUGCCGGACUCCGGCAGGACAACGAGGAGGAACGUGAUCGAGGAUUCGGCGGAUGCGUUCCCGUGCAGUCUCUGUGCGCGUAACGAAGUCAGAAAUAUGCGGGCGACCGCAAAACAAAGGGGCUUUGAACAGAGGAU
RS 3 dot .(((……..)))((.((.(((((((((…)))))))).)..)).)).((((((((.(((………))).))))))))((((((…….))))))…(((((((…….(((((….)))))………)))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table