Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108139 Similarity: 0.975 Similarity: 0.974 Similarity: 0.972
UTR: 5HSAA108139
Gene: TCP11
MFE: -51.144
ENS: 0.879
Length: 112.
Predicted Ligands:
glycine - 7/20
TPP - 5/20
SAM - 4/20
 RS: URS0000AB2095_1055526
MFE: -40.746
Ligand: glycine
Species: Candidatus Burkholderia kirkii UZHbot1 Glycine riboswitch
 RS: URS0000D9F306_1945864
MFE: -29.485
Ligand: TPP
Species: Hydrogenophaga sp. A37 TPP riboswitch (THI element)
 RS: URS0000AB7020_205918
MFE: -43.554
Ligand: homocysteine
Species: Pseudomonas syringae pv. syringae B728a S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108139 URS0000AB2095_1055526 URS0000D9F306_1945864 URS0000AB7020_205918
Length 112. 112. 113. 111.
Similarity - 0.975 0.974 0.972
Ensemble Norm 0.879 - - -
MFE -51.144 -40.746 -29.485 -43.554
Ligands - glycine TPP homocysteine
Gene TCP11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3. 12.001
Length SE - 0. 1. 1.
Lev Distance - 31. 33. 31.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 4. 2. 3. 4.
ILR 3. 3. 3. 3.
H 2. 1. 1. 1.
BL 1. 2. 2. 2.
BR 3. 4. 3. 6.
UN 0.036 0.018 0.018 0.063

Sequences

Field Description
UTR seq + 25 accgugcgacgccccaacccgccgcuccgccgcggugguacgcuccaggccgccaggccgcgaggcccaccgagcggacgccaguggATGACCCGCGGCGGGGGAGGAGGAG
UTR dot + 25 ..(((…)))((((..(((((((((((((..((((((..(.(((..((((….))))..)))).)))))).)))))…………….))))))))…)).))..
RS 1 seq CCGCACGCGUCGGGAGAGCGCGUGGCCGCCGCUUGGCUCGACCAAAGCGAACGCCGCGCCGCCGAAGGCGGCAUACCCGCAAACUCUCAGGCAAAAGGAUCGACGGCGUCGA
RS 1 dot .((.((((((((((((((((.(((((((((..(((((………(((…..)))…))))).)))))).))).)))….))))………..))))).)))))).
RS 2 seq CGCCCUGCUCCGGGGUGCACAGGCCGCAAGGUCCAGCGCUGAGAUGGUUGAACAACCGAACCCGUGAACUUGAUCUGGCUAGUACCAGCGAAAGAAGAGCGCAGCCCCCAGGG
RS 2 dot ..(((((….(((((((((.((((…(((((.(((((…..(((((….)))))…..)))..)).))))))))).))……………..))).)))))))))
RS 3 seq CUGUCCGAGGGGCGCUGCAGCAGGUUUUCCCUGUCAGGCUCGGAUGGGGCGUUGUUUGCCAGGACGAUCCUCGACCGGCAAACCUUAAACGCACAACGGCGCCCAUUCGCA
RS 3 dot …..((((((((((((..((((((((..((.((((((.(((..(..((((…..)))).)..))).))).))).)).))))))…..))….)))))))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table