Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108260-0 Similarity: 0.979 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA108260-0
Gene: TDP1
MFE: -38.014
ENS: 0.919
Length: 101.
Predicted Ligands:
TPP - 11/20
purine - 5/20
zmp-ztp - 1/20
 RS: URS000232A606_1838281
MFE: -44.335
Ligand: zmp-ztp
Species: Streptomyces sp. SolWspMP-5a-2 ZMP/ZTP riboswitch
 RS: URS0000C3A5CC_33978
MFE: -18.527
Ligand: TPP
Species: Caryophanon tenue TPP riboswitch (THI element)
 RS: URS0000DA2E11_1678001
MFE: -19.037
Ligand: purine
Species: Bacillus sp. MUM 13 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108260-0 URS000232A606_1838281 URS0000C3A5CC_33978 URS0000DA2E11_1678001
Length 101. 102. 100. 102.
Similarity - 0.979 0.976 0.976
Ensemble Norm 0.919 - - -
MFE -38.014 -44.335 -18.527 -19.037
Ligands - zmp-ztp TPP purine
Gene TDP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 4.001 2.
Length SE - 1. 1. 1.
Lev Distance - 26. 29. 30.
UBS 8. 9. 7. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 4. 4. 3. 5.
H 2. 2. 2. 2.
BL 3. 3. 2. 3.
BR 2. 1. 1. 2.
UN 0.030 0.029 0.060 0.029

Sequences

Field Description
UTR seq + 25 gcgcaugcgcggcggccgccgaaggggcgggauccgaggcaagcguugguucugugcgccucagacugcgaguauaATGTCTCAGGAAGGCGATTATGGGA
UTR dot + 25 ((((.(((.(((…(((((…..)))))…)))..))).))))…((((((((((((….(((.((……..)).)))..)))))..)))))))
RS 1 seq GUCCUGGGCCGUGACUGGCGCUGAGGUGGAGCACCACCGGGGAGCGGUCUGACGACUGCGCACAUCGACGAGCCGUCGUGCCGUCGUCGUGGGGCGCAGUGC
RS 1 dot (((..(((((((..((((.(((…….))).)))….)..)))))))))).(((((((.((((((((.((……)))))))..)))..)))))))..
RS 2 seq CUUUAAUUGCGGGGGGACACGACGAGUGUUGAGAAGGUUAAAACCUGACCCUUAGAACCUGACAGUUAAUACUGGCGUAGGGAGCAAUGAGUGGCAGCAG
RS 2 dot .(((((((…….(((((…..)))))…..)))))))..(((.((((((…((((.((((….))))…))))……)))).)))))…
RS 3 seq AUCAUAAUAAUAUAUGUUCGUCGUAUAAUAUUGGGGAUAUGGCCCAAAAGUUUCUACCGAGCUGCCGUUAACAGCUUGACUACGAUGUGAUUGAAAAGGCUG
RS 3 dot (((.(((((.((((((…..)))))).)))))..)))..(((((((..(..((((.(((((((…….)))))))..)).))..)..)))….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table