Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108260-1 Similarity: 0.976 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA108260-1
Gene: TDP1_0
MFE: -40.207
ENS: 0.942
Length: 101.
Predicted Ligands:
TPP - 17/20
GMP - 1/20
zmp-ztp - 1/20
 RS: URS0000DD377F_1631247
MFE: -35.831
Ligand: TPP
Species: Mesorhizobium delmotii TPP
 RS: URS0000AD70C0_1631249
MFE: -33.431
Ligand: TPP
Species: Mesorhizobium prunaredense TPP
 RS: URS0000C75253_1678129
MFE: -32.688
Ligand: TPP
Species: Limnohabitans sp. 103DPR2 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108260-1 URS0000DD377F_1631247 URS0000AD70C0_1631249 URS0000C75253_1678129
Length 101. 101. 101. 101.
Similarity - 0.976 0.976 0.976
Ensemble Norm 0.942 - - -
MFE -40.207 -35.831 -33.431 -32.688
Ligands - TPP TPP TPP
Gene TDP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.012 4.012 9.
Length SE - 0. 0. 0.
Lev Distance - 31. 31. 29.
UBS 9. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 1. 1. 1.
H 4. 4. 4. 5.
BL 2. 1. 1. 0.
BR 2. 2. 2. 1.
UN 0.040 0.149 0.149 0.030

Sequences

Field Description
UTR seq + 25 acugcgcgcaugcgcggcggccgccgaaggggcgggauccgaggcaagcguugguucugugcgccucaggaguauaATGTCTCAGGAAGGCGATTATGGGA
UTR dot + 25 .((((.(((….)))))))(((((…..)))))…((((.(….).))))(((((((((((((..(((……..)))..)).))))..)))))))
RS 1 seq CGCCAUCCACAGGGGUGCUCCGUGUCGUCGGGGCUGAGAGACGGGCUGCAAGCCCGUAAACCCUAGAGCUGAUCUGGAUAAUACCAGCGGAGCGAGGCGGG
RS 1 dot …(((((….)))))(((((……)))))…….(((((((…)))))))…((((.(..(((..((((……)))))))..).))).)..
RS 2 seq CGCCAUCCACAGGGGUGCUCCGUAUCGCCGGGGCUGAGAGAUGGGCUGCAAGCCCGUAAACCCUAGAGCUGAUCUGGAUAAUACCAGCGGAGCGAGGCGGG
RS 2 dot …(((((….)))))(((((……)))))…….(((((((…)))))))…((((.(..(((..((((……)))))))..).))).)..
RS 3 seq CACAUCCGCUAGGGGUGUUUUGGCUGACCAGCCAAGACUGAGAAAGUCCCUUUGAACCUGAUUGAGGUAAUCCUCGCGCAGGGAAGCUUGUCUAAACAACG
RS 3 dot .((((((…..)))))).((((((….))))))((((…..)))).((((…((((..(((((….)))))..))))))))(((((….)))).)

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table