Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108354 Similarity: 0.955 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA108354
Gene: TECPR2
MFE: -56.482
ENS: 0.733
Length: 153.
Predicted Ligands:
FMN - 11/20
cobalamin - 5/20
guanidine - 1/20
RS: URS0000C4E23B_1328313
MFE: -43.079
Ligand: guanidine
Species: Catenovulum agarivorans DS-2 Guanidine-I riboswitch
RS: URS0000AB83B5_319795
MFE: -62.440
Ligand: FMN
Species: Deinococcus geothermalis DSM 11300 FMN riboswitch (RFN element)
RS: URS0000C7DB15_237609
MFE: -55.240
Ligand: FMN
Species: Pseudomonas alkylphenolia FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108354 URS0000C4E23B_1328313 URS0000AB83B5_319795 URS0000C7DB15_237609
Length 153. 153. 153. 153.
Similarity - 0.955 0.953 0.953
Ensemble Norm 0.733 - - -
MFE -56.482 -43.079 -62.440 -55.240
Ligands - guanidine FMN FMN
Gene TECPR2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.015 10.003 2.003
Length SE - 0. 0. 0.
Lev Distance - 54. 58. 62.
UBS 11. 12. 11. 12.
BS 0. 0. 1. 0.
ILL 1. 2. 1. 1.
ILR 2. 5. 2. 2.
H 3. 3. 2. 4.
BL 3. 4. 5. 3.
BR 4. 3. 6. 4.
UN 0.026 0.150 0.085 0.078

Sequences

Field Description
UTR seq + 25 aucccgccuccuccggcccggcggggccgacgaguccggaggggcugccgcgggagcccccagguuucccuagaugacaaauaaacauuccuuuuccugcgugaagauagucuguggaaaccuuggccATGGCATCGATATCAGAGCCTGTTA
UTR dot + 25 .(((((((((((((((((((((…))))..).).)))))))))…..))))))(((…((((((((.(((((…………………………….))))).)))))))).)))((.(((.((…….)))))))…
RS 1 seq UAAACGGGCGACUAGGGUUCCGGUUUGUUACUAAAACAAAUGCCUGGUCCGAGAGUUGCCAACCUAGCUGCACAACUUCCUAAAGCAAUGUUGCUUGUGGUUUUAGUGUUUGCGUCAGCAAGGGUUACACGGCGGGAUAAAAGCCCGGGAGGU
RS 1 dot ……(((((((.(((..((((((((((…..))))))…)))))))…)))))))..(((.(((((.(((((.((..(((((….)))))..))….)))…)).).)))).)))………((((…….))))……
RS 2 seq CGCUUCCUUCGGGGCGGGGUGAAAUUCCCCACCGGCGGUGAUCCGGCUCUGGCCGGUCAGCCCGCGAAGCCCGCGCAAACUGCACCACGCGCGAGGCCCGACUCCGUGCGAUUCGGAGGCCGACGGUCACAGUCCGGAUGAGAGAAGGAGGAA
RS 2 dot ..((((((((..((.((((…….)))).))…..(.((((((((.(((((.(((.(((..((((((((((((…………))))).)))…………..))))..))).)))))))).)).)))))).)..))))))))..
RS 3 seq CAACGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAAUUGCGCAACCUGCGCAUAGCCCGCGAGCGCUUGCAGGCUUGCCUUGCAAGGUCAGCAGACCCGGUGUGAUUCCGGGGCCGACGGUCAUAGUCCGGAUAAAGAGAGAACGGGA
RS 3 dot …(((((.(.(((((((((((((((((((…)).)).))))))))..)))…….))))).)))))((((((((…..))))))))(((.((…(((((…….))))))).)))……..((((………….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table