Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108863 Similarity: 0.975 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA108863
Gene: TGIF2
MFE: -44.618
ENS: 0.791
Length: 111.
Predicted Ligands:
TPP - 18/20
cobalamin - 1/20
glycine - 1/20
RS: URS00008679AA_1499688
MFE: -33.403
Ligand: TPP
Species: Bacillus sp. LF1 TPP riboswitch (THI element)
RS: URS0000C6759A_1685382
MFE: -38.920
Ligand: TPP
Species: Ponticoccus sp. SJ5A-1 TPP riboswitch (THI element)
RS: URS00023267F8_1736324
MFE: -50.580
Ligand: cobalamin
Species: Aeromicrobium sp. Leaf289 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108863 URS00008679AA_1499688 URS0000C6759A_1685382 URS00023267F8_1736324
Length 111. 110. 111. 112.
Similarity - 0.975 0.975 0.974
Ensemble Norm 0.791 - - -
MFE -44.618 -33.403 -38.920 -50.580
Ligands - TPP TPP cobalamin
Gene TGIF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 3.001 1.001
Length SE - 1. 0. 1.
Lev Distance - 30. 33. 33.
UBS 8. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 3. 1. 2. 3.
H 2. 2. 3. 2.
BL 3. 2. 2. 3.
BR 1. 1. 1. 2.
UN 0.090 0. 0.126 0.054

Sequences

Field Description
UTR seq + 25 ccgacggcccgccccgcggggggugggcgcagcucgucgcgcuccgcacaaaguuuacccaagguccagccuagccccuaggcaccATGTCGGACAGTGATCTAGGTGAGG
UTR dot + 25 ……(((((((((….))))))))).((.((.(((((..((((.(((..((…………..((((((…))))))))..)))))))..)))))..)).))…
RS 1 seq UUCUAUCACUAGGGGAUCCCUUGAUAAGGGCUGAGAGCAGAGUAGUUACUUUGAAACCCUCUAAACCUGAACAGGUUCGUACCUGCGUAGGGAAGUGGCGCGCUGUUUUA
RS 1 dot …(((((..((((…)))))))))…….(((((((.((.((((((((………….((((..(((((….)))))..)))))))))))))).))))))).
RS 2 seq AAGCCUACCUCGGGGUGGCGGAGCGUGAUCCGCCUGAGAUUUGCGUGACCGCAUCAACCCGUUGAACCUGAACCGGUUAGCACCGGCGGAGGGAAGGCAUGGCACGCUGCG
RS 2 dot ..((((……))))((((((……))))))……..(((((.(((..((..(((.(((……..(((((….)))))))).)))..))..))))))))….
RS 3 seq ACCGCGAUCCGUCGCCGCGGAUCAGGGAAGCCGGUGCGAGUCCGGCGCGGUUCCGCCACUGUGACGCCUGCCUGCAGGCCAGCCAGACACCUUCCGCGGCGACUCCCACCGC
RS 3 dot .((..(((((((….)))))))..))….(((((.((((.((.(((((……..(((….(((((….)))))….)))…….))))).)))))).))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table