Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108869 Similarity: 0.987 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA108869
Gene: TGIF2LX
MFE: -19.449
ENS: 0.902
Length: 74.
Predicted Ligands:
fluoride - 13/20
cobalamin - 4/20
SAM - 2/20
 RS: URS0000D92FA7_29540
MFE: -29.479
Ligand: fluoride
Species: Natrialba asiatica DSM 12278 Fluoride riboswitch
 RS: URS0002335240_1348662
MFE: -23.976
Ligand: cobalamin
Species: Corynebacterium argentoratense DSM 44202 Cobalamin riboswitch
 RS: URS000231B6D6_408172
MFE: -12.836
Ligand: cobalamin
Species: marine metagenome AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108869 URS0000D92FA7_29540 URS0002335240_1348662 URS000231B6D6_408172
Length 74. 73. 73. 75.
Similarity - 0.987 0.984 0.984
Ensemble Norm 0.902 - - -
MFE -19.449 -29.479 -23.976 -12.836
Ligands - fluoride cobalamin cobalamin
Gene TGIF2LX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.013 3.001 10.004
Length SE - 1. 1. 1.
Lev Distance - 16. 20. 18.
UBS 4. 3. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 0. 2. 1.
H 3. 3. 2. 2.
BL 0. 0. 1. 2.
BR 0. 0. 0. 2.
UN 0.189 0.301 0.151 0.253

Sequences

Field Description
UTR seq + 25 cgcuguuugucuuucucggaaacaacaguaacgauaagccucuuggaauATGGAGGCCGCTGCGGACGGCCCGG
UTR dot + 25 .((((((..(((…..)))…))))))……..((((((……..)))))).((((….))))….
RS 1 seq CCCCCUUCGGGCGAUGGGGCCCGCCCGACCCAACCGCCGGCACCGACCGCCGGCUGACGGUCCCUGCCACUAC
RS 1 dot ……(((((((……..)))))))…….((((((…….))))))….(((….)))…..
RS 2 seq AGGGAACCCGGUGCAAAUCCGGGACUGUCCCGCAACGGUAAUCGUGUCUAAACAACACGAAAGUCCGAUACCU
RS 2 dot .((((.(((((…….)))))….))))….(((…((((((…….))))))….)))……
RS 3 seq CAUUUGAAGUAGGGAAAAUUCUGUAAAUUCAGAUACUACACCCGUAACGGUUAAAAGUCCGAACGCCUACAAGAA
RS 3 dot .(((((((.((.(((….))).))..)))))))……..(((..(((……..))).)))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table