Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108870 Similarity: 0.984 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA108870
Gene: TGIF2LY
MFE: -21.343
ENS: 0.811
Length: 89.
Predicted Ligands:
zmp-ztp - 7/20
glycine - 5/20
TPP - 3/20
 RS: URS0000C3A79E_1531966
MFE: -21.662
Ligand: TPP
Species: Torrubiella hemipterigena TPP riboswitch (THI element)
 RS: URS0000DAA5C0_700508
MFE: -30.890
Ligand: fluoride
Species: Mycobacterium sp. VKM Ac-1815D Fluoride riboswitch
 RS: URS0000C0967B_1423726
MFE: -22.505
Ligand: TPP
Species: Lactobacillus bifermentans DSM 20003 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108870 URS0000C3A79E_1531966 URS0000DAA5C0_700508 URS0000C0967B_1423726
Length 89. 90. 88. 90.
Similarity - 0.984 0.981 0.981
Ensemble Norm 0.811 - - -
MFE -21.343 -21.662 -30.890 -22.505
Ligands - TPP fluoride TPP
Gene TGIF2LY - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 8.005 3.001
Length SE - 1. 1. 1.
Lev Distance - 20. 22. 24.
UBS 7. 7. 7. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 0. 2.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 3. 4. 1.
BR 2. 3. 2. 1.
UN 0.079 0.111 0.148 0.056

Sequences

Field Description
UTR seq + 25 caacucuguuagcaaagcuguuugucuuucucggaaacaacaguaacgauaagccucuuugaauATGGAGGCCGCTGCAGACGGCCCGG
UTR dot + 25 …((((((…(((((..(((((((.((((.(…….))).)).)))))))..)))))…))))))((((…….))))….
RS 1 seq AGGCUGUUGCGAUGGAGCUUGUGGCUGAGAAUAUACGGCCCUGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCCUUCCUCCAUC
RS 1 dot ..((((((..(((.(((.(((.(((((……..))))).))).))).)))..))……))))…((((……..))))…..
RS 2 seq CUCGACGACGGCGAUGGAUCUCCGCCGAGACGCCCGGUGACAGGUGUCUGAACCGCCUCGUCCGGAGGCUGAUGGCUCCUUUCCCCGA
RS 2 dot …(((((.((((.(((((((.(((((…….)))))…)).)))))…))))))))).((((.(….).))))………
RS 3 seq GUUAUCUGCAAGGGGCGCCUGUGUGGCUGAGAUUGAACCCUGGAACCUGAUCUGGUUAACACCAGCGGAGGAAUGCAGCUGAUAAUUCAG
RS 3 dot …..(((((…..(((..((((((((.((((((…………))))))))))).)))..)))……)))))((((….))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table