Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108940 Similarity: 0.955 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA108940
Gene: THADA
MFE: -48.782
ENS: 0.977
Length: 165.
Predicted Ligands:
Mg2+ - 9/20
TPP - 5/20
FMN - 4/20
 RS: URS0000D9BBC8_1903704
MFE: -46.651
Ligand: FMN
Species: Tumebacillus sp. AR23208 FMN riboswitch (RFN element)
 RS: URS0000DA4B4B_1797636
MFE: -66.757
Ligand: FMN
Species: Chloroflexi bacterium RBG_13_60_9 FMN riboswitch (RFN element)
 RS: URS0000D92E39_136273
MFE: -83.599
Ligand: FMN
Species: Kocuria polaris FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108940 URS0000D9BBC8_1903704 URS0000DA4B4B_1797636 URS0000D92E39_136273
Length 165. 164. 166. 164.
Similarity - 0.955 0.953 0.953
Ensemble Norm 0.977 - - -
MFE -48.782 -46.651 -66.757 -83.599
Ligands - FMN FMN FMN
Gene THADA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 14. 14.012
Length SE - 1. 1. 1.
Lev Distance - 50. 53. 53.
UBS 13. 15. 12. 14.
BS 0. 0. 0. 0.
ILL 4. 5. 3. 6.
ILR 3. 5. 4. 5.
H 1. 3. 2. 1.
BL 6. 5. 5. 5.
BR 6. 5. 3. 4.
UN 0.121 0.122 0.139 0.012

Sequences

Field Description
UTR seq + 25 gacccgguagucgaccguggaccgcgcugcgagccucggagacgccguagaaggagaccugcuuccgggacuggaccaggcgccugcgacucuucucagacgccgacgugcacgagugacuacuauuaauucuauuuaaaATGGGTGTAAAGAAGAAGAAAGAAA
UTR dot + 25 .((((((((((((..((((.((.((((((.((…..((((.(((……(((.(.((((..((((….)))).))))).)))))).)))))).))).)))….)).))))..))))))))………………))))……………….
RS 1 seq UAGUUCCUUCAGGGUAAGGUGAGACGGCAACUGGCCGUCAAUUCCUAAUCGGCGGUGAUGACUCUUUUGCUUCGGCAUAGGCAGGCUAAGUCCGCGAGCCUUCACAGGCAGGAACUGGUGCGAAUCCAGUACCGACGGUAUAGUCCGGAUGGGAGAAGGAAUGA
RS 1 dot .(((((((.(..(..(((((..(.(((..((((((((((.((.((…..(((((.((….))..)))))..)).)).))).))))).))))))..)))))..)..).)))))))(((((…….)))))..(((……)))……………..
RS 2 seq AAUAUCCUUCGGGGCCGGGUGAGGACCGCGUGCUGGUCCAAUUCCCGAUCGGCGGUAAGCCGGCAGUAAAGCCGGCAAGCCCGCGAGCCAAAGCGGAAUUUCCGCAGCGGCAUGAUCCGGUGUGAUUCCGGAGCCGACCGUAUAGUCGGGAUGAAAGAAGGAAAAG
RS 2 dot ……((((((((((((((.(.(.((((.(((.((…((((((…..((((((..((((((……))))))..)))…..)))…..)))))).)))))))))).).)))))))…..)))))))(((((……)))))……………..
RS 3 seq CAACGUGUUCCGGGGUCGGUGGAAGUCCGAACCGGCGGUCACAGUCCGCGAACCGGACGACCACGUCCCUGCGGGCGCCCAGCGCCCGCACCGACGGGUCGUCCGGCCGAACCGGUGGAACUCCGGUACCGACAGUCACAGUCUGGAUGGAAGGCAACACGUUC
RS 3 dot .(((((((((((((.(..((((..(((.(.(((((.(((..((..(((((..((((((((((.((((..(((((((((…)))))))))..)))))))))))))).))…)))))..)))))))).).)))..))))).))))))………))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table