Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108945 Similarity: 0.960 Similarity: 0.958 Similarity: 0.956
UTR: 5HSAA108945
Gene: THAP10
MFE: -71.013
ENS: 0.817
Length: 167.
Predicted Ligands:
FMN - 12/20
cobalamin - 4/20
Mg2+ - 3/20
 RS: URS0000C28387_1263013
MFE: -49.509
Ligand: lysine
Species: Firmicutes bacterium CAG:240 Lysine riboswitch
 RS: URS0000C3B465_159450
MFE: -71.719
Ligand: FMN
Species: Burkholderia sacchari FMN riboswitch (RFN element)
 RS: URS0000C46FD9_1385517
MFE: -62.969
Ligand: FMN
Species: Lysobacter daejeonensis GH1-9 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108945 URS0000C28387_1263013 URS0000C3B465_159450 URS0000C46FD9_1385517
Length 167. 166. 167. 166.
Similarity - 0.960 0.958 0.956
Ensemble Norm 0.817 - - -
MFE -71.013 -49.509 -71.719 -62.969
Ligands - lysine FMN FMN
Gene THAP10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 5. 6.
Length SE - 1. 0. 1.
Lev Distance - 48. 53. 54.
UBS 14. 13. 14. 14.
BS 0. 1. 1. 2.
ILL 2. 1. 2. 3.
ILR 2. 1. 2. 2.
H 4. 5. 4. 4.
BL 7. 7. 7. 7.
BR 7. 6. 5. 8.
UN 0.078 0.054 0.072 0.072

Sequences

Field Description
UTR seq + 25 ccagagguagggaaggaaacaaucccgacccggaguggacaggugaggaggggaggacuugccucgccgaggccgcugcgaggagcgugcccaagggcgaagguccagggaacccggcucccgcgcaccgaagacggccgccATGCCGGCCCGTTGTGTGGCCGCCC
UTR dot + 25 …..(((.((((………)))).)))((.(((((.(.(((((((.(((…..))).)))))))..).))))).))..((((((.(((..((((….)))).))).))…))))(((((((.((…..(((((……))))))).)))))))……
RS 1 seq AGGCAUGAUAGAGGCGCGGUCGCCAUCAGUAGCUUAGUUUAAAACGCCGGGAAGCGUUAAGCGAAAGGGGCUAUCGCCGAAGGGUUCGGCUUUCCCGAGGUCGGAUGCCUGGGAUGCAGGAGAAUAUUCUGCAUACUGUCGCUUUAUGCGGAGAGCUGUCAUGAUC
RS 1 dot …((((((((.((((….))))..(.(((((((.(((((..((((……)))))))))…..))))))).)((.(.(.((((((((((…)))))))))).).).))((((((((…..)))))))).((.((((…..))).).))))))))))…
RS 2 seq GUGCGUCUUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUAUGCCGGCCGCGCCGCAAGGCAAGGCCGACGAGCCCGCGAGCGCCUGCGCGAAGCCUUUCGCGCAGGGUCAGCAGAUCUGGUGCGAUGCCAGGGCCGACGGUCAUAGUCCGGAUGAAAGAAGAUGUGC
RS 2 dot ((((((((((..((.((((…….)))).))…(((.((.(((((..(((….)))..))))).)).))).((..((.((((((((((….))))))))))))..))..((((((.((.(((((.(……))).))).))))))))….))))))))))
RS 3 seq CGACGUCUUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAGGUCGCACGGCCCCGGUCGUGCCACAAGCCCGCGAGCGCUUCCCGACGCCUCAGGCAUCGGCAAGGUCAGCAGAUCCGGUCCAAUGCCGGAGCCGACGGUCAUAGUCCGGAUGAAAGAAGACGGCG
RS 3 dot ((.(((((((..((.((((…….)))).))…(((..((.(((((((….))))))).))..))).((..((.(((.((((.(((…))).)))).)))))..))..((((((.(..((((((…….))).))).).))))))….))))))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table