Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108964 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA108964
Gene: THAP6
MFE: -35.089
ENS: 0.859
Length: 122.
Predicted Ligands:
guanidine - 8/20
TPP - 6/20
glycine - 3/20
 RS: URS0000C84EF1_1736594
MFE: -53.518
Ligand: glycine
Species: Sphingomonas sp. Root710 Glycine riboswitch
 RS: URS0000AB78CD_87883
MFE: -55.080
Ligand: TPP
Species: Burkholderia multivorans TPP
 RS: URS0000ABD25D_395019
MFE: -55.080
Ligand: TPP
Species: Burkholderia multivorans ATCC 17616 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108964 URS0000C84EF1_1736594 URS0000AB78CD_87883 URS0000ABD25D_395019
Length 122. 120. 122. 122.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.859 - - -
MFE -35.089 -53.518 -55.080 -55.080
Ligands - glycine TPP TPP
Gene THAP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2. 2.
Length SE - 4. 0. 0.
Lev Distance - 31. 37. 37.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 3. 2. 2. 2.
H 3. 3. 3. 3.
BL 3. 4. 3. 3.
BR 3. 3. 2. 2.
UN 0.090 0.092 0.074 0.074

Sequences

Field Description
UTR seq + 25 ucccggggcuacgaggcggaagcgaaggcagacgcagucuccgucguugacguuagucgcagucuucgcugcuaacguuuuguuaugaguugcuaaaATGGTGAAATGCTGCTCCGCCATTG
UTR dot + 25 …(((((((.(((((((..(((((.((.((((…)))))).)))))..))))..))).))))).))((..((((…..))))..))…….(((((((………..))))))).
RS 1 seq CGACACUCUGGAAAGCGGAUGGCCGCGUCGGGAAACUGGCGGGGUCGUCCCACCGAAGGGGUAAGCCGGACCGGCUCAGGUGCGGCGAAAGCUCUCAGGUUCCGUGACAGAGGGGGCAAU
RS 1 dot ..((.((((((…(.((((((((.((((((….)))))).))))))))).))..))))))..((((.(((……))).))))….((((((..(((….)))…))))))…
RS 2 seq ACGACGAAACAGGGGUGCUUCGUGCGCGGCCGACGGUGUUCCGGGCGGCGCGGCGAGGCUGAGAAAGACCCUUCGCACCCGAUCCGGGUAAUACCGGCGAGGGAAGUUUCUGAUCCCGCCGG
RS 2 dot ….(((….((((((((((((((((.(((..(((….)))))).))))).))))))……..)))))))).(((((…)))))….((((((.(((.((…))..)))))))))
RS 3 seq ACGACGAAACAGGGGUGCUUCGUGCGCGGCCGGCGGUGUUCCGGGCGGCGCGGCGAGGCUGAGAAAGACCCUUCGCACCCGAUCCGGGUAAUACCGGCGAGGGAAGUUUCUGAUCCCGCCGG
RS 3 dot ….(((….((((((((((((((((.(((..(((….)))))).))))).))))))……..)))))))).(((((…)))))….((((((.(((.((…))..)))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table