Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108965-1 Similarity: 0.972 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA108965-1
Gene: THAP6_0
MFE: -38.739
ENS: 0.899
Length: 133.
Predicted Ligands:
guanidine - 11/20
glycine - 3/20
molybdenum - 2/20
 RS: URS0000C1972A_1413211
MFE: -39.334
Ligand: molybdenum
Species: Tepidibacillus decaturensis Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB59C7_350701
MFE: -57.596
Ligand: guanidine
Species: Burkholderia dolosa AUO158 Guanidine-I riboswitch
 RS: URS0000ABCB18_216591
MFE: -55.
Ligand: guanidine
Species: Burkholderia cenocepacia J2315 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108965-1 URS0000C1972A_1413211 URS0000AB59C7_350701 URS0000ABCB18_216591
Length 133. 131. 134. 132.
Similarity - 0.972 0.972 0.971
Ensemble Norm 0.899 - - -
MFE -38.739 -39.334 -57.596 -55.
Ligands - molybdenum guanidine guanidine
Gene THAP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6. 6.
Length SE - 4. 1. 1.
Lev Distance - 29. 34. 35.
UBS 10. 9. 11. 11.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 3. 1. 3. 3.
H 3. 3. 3. 3.
BL 3. 4. 5. 5.
BR 3. 4. 2. 2.
UN 0.083 0.084 0.067 0.068

Sequences

Field Description
UTR seq + 25 ucccggggcuacgaggcggaagcgaaggcagacgcagucuccgucguugacguuagucgcagucuucgcugcuaacgggauuuccgguuuuuguuaugaguugcuaaaATGGTGAAATGCTGCTCCGCCATTG
UTR dot + 25 …(((((((.(((((((..(((((.((.((((…)))))).)))))..))))..))).))))).))((..((((((((……..))))))))..))…….(((((((………..))))))).
RS 1 seq AUAUAGUAACUUCUUCGAGCAUAUUAGCCUAAGGUUAAUCUAUGGCUGGUACGCCUGAGCAGUUAGCUCACAGGGUAUAUCUGGAAACGGAUAUGCCUUCCGUUAUGAAAAGAAGGGGGGAUUUUUAUAGA
RS 1 dot ….(((((((.(((.(.((.((((((((..((……))..)))))))).))).))).))))).))…((((((((((((….))))))))))))…(((((((((……….))))))))).
RS 2 seq CUUCAGGAUCGCUAGGGUUCCGGUCGCACGGCGUCACACGCCGAGCGACGUCUGGUCCGAGAGCAAUCCGGUCUUGCCGCCUGCCUUUGCGAGGCCCCGGCGAGGCUCCACGGAGGGACAAAAGCCCGGGAGGU
RS 2 dot …..((((.(((.(((..((((((((.((((((…)))))).)))))…))))))…))).)))).(((((((((…(((((…)))))..)))))))))(((.(((.(………)))))))…
RS 3 seq CUUCAGGAUCGCUAGGGUUCCGGUCGUGCGGCAUGUGCCGUGCGAUGUCUGGUCCGAGAGCAAUCCGGUCUUGCCUUCGCCUCGAUGAGAGGAAACGGCGAGGCUCCACGGAGGGAUAAAAGCCCGGGAGGU
RS 3 dot …..((((.(((.(((..(((((((((((((….)))))))))…)))))))…))).))))..(((((((.(..((((…..))))..).)))))))((((.(((.(………))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table