Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108966 Similarity: 0.957 Similarity: 0.955 Similarity: 0.953
UTR: 5HSAA108966
Gene: THAP6_2
MFE: -48.260
ENS: 0.946
Length: 156.
Predicted Ligands:
cobalamin - 7/20
FMN - 6/20
glycine - 3/20
RS: URS00023298AE_449447
MFE: -29.458
Ligand: cobalamin
Species: Microcystis aeruginosa NIES-843 Cobalamin riboswitch
RS: URS0000D9E1E7_1247936
MFE: -54.692
Ligand: glycine
Species: Paraburkholderia ribeironis Glycine riboswitch
RS: URS000231294E_1618776
MFE: -27.565
Ligand: cobalamin
Species: Candidatus Nomurabacteria bacterium GW2011_GWF2_40_12 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108966 URS00023298AE_449447 URS0000D9E1E7_1247936 URS000231294E_1618776
Length 156. 156. 155. 155.
Similarity - 0.957 0.955 0.953
Ensemble Norm 0.946 - - -
MFE -48.260 -29.458 -54.692 -27.565
Ligands - cobalamin glycine cobalamin
Gene THAP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.002 7. 4.
Length SE - 0. 1. 1.
Lev Distance - 52. 55. 60.
UBS 12. 11. 13. 13.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 5. 3. 3. 4.
H 3. 3. 3. 3.
BL 5. 4. 6. 5.
BR 2. 4. 3. 3.
UN 0.058 0.103 0.065 0.071

Sequences

Field Description
UTR seq + 25 ucccggggcuacgaggcggaagcgaaggcagacgcagucuccgucguugacguuagucgcagucuucgcugcuaacgggauuuccgguauuccccacagaugaaaacaucaaaaggaaauggguauuagcaATGGTGAAATGCTGCTCCGCCATTG
UTR dot + 25 (((((.(((..(((((((..(((((.((.((((…)))))).)))))..))………..)))))..)))..)))))…((.((.((((…..((((….))))….)))))).))……((((((((………..))))))))
RS 1 seq CAACCGAAAACGUGGUAUAAUAUUUAAGCUUGUCUUUGGGAAAGUCCAGUGCAAUUCUGGUACUGUGCCGCAGCUGUAAUCAAGUAAAAAGUAAAAAGAGUACAUCUUCCCUUUUUCCUUGCGAGUCAGAAUGCCAAUUACAAGUUUUUAAUCGGU
RS 1 dot ………..((((((((.((((..((.((((..(((((….))))).))))))..)))).))))))))..(((….((((.((((((….((((…..))))..)))))).))))…..)))…(((.((((……..)))).)))
RS 2 seq UUUUCGCACUCUGGAGAGCGGCAGUAGCCAUCUGCGUCGUUUGUAUCGUGCAGGCACAGGCAGGCUGCCCACCGAAGGGGCGCGCGUUUCACCGUGACGAAUCCAGAUUCUCACGGCAGCGCAAUCUCUCAGGUAUCGAGGACAGAGGGGUCAUG
RS 2 dot ….(((.((((((…(.((((((.(((.((((((.((…….))))))))….)))..))))))).))..))))))).(((((…((((((.((((….)))))))))).))))).(((((((..((…….)).)))))))….
RS 3 seq GGUAAGUAUAUACUAAAUGAGUUCCUUUUUAAAAAUAUAAGAAAUGAUUUGGGGAAACUGGUUAGAUUCCAGUGCAGUGCCGCUACGGUAAGUCCUGAUACGCCAUUUGGCGAGAAGGAACAAGCCCGACUACCAAUCAUUUUACUUGUCCCGAG
RS 3 dot ((((.((((((.((.(((.((((((((…………………..)))))).)).)))))))….))))..))))…..(((..(((((..(.((((….)))))..)))).)..))).(((……………..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table