Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108986 Similarity: 0.967 Similarity: 0.966 Similarity: 0.964
UTR: 5HSAA108986
Gene: THAP9
MFE: -46.446
ENS: 0.996
Length: 144.
Predicted Ligands:
cobalamin - 12/20
FMN - 7/20
tetrahydrofolate - 1/20
 RS: URS0000C52663_189381
MFE: -41.031
Ligand: FMN
Species: Bacillus marisflavi FMN riboswitch (RFN element)
 RS: URS0002319A0A_1662404
MFE: -59.812
Ligand: cobalamin
Species: Streptomyces sp. GKU 895 Cobalamin riboswitch
 RS: URS0002321F47_196162
MFE: -61.122
Ligand: cobalamin
Species: Nocardioides sp. JS614 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108986 URS0000C52663_189381 URS0002319A0A_1662404 URS0002321F47_196162
Length 144. 144. 143. 144.
Similarity - 0.967 0.966 0.964
Ensemble Norm 0.996 - - -
MFE -46.446 -41.031 -59.812 -61.122
Ligands - FMN cobalamin cobalamin
Gene THAP9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 5. 4.
Length SE - 0. 1. 0.
Lev Distance - 43. 42. 46.
UBS 12. 13. 13. 11.
BS 0. 0. 0. 0.
ILL 3. 4. 4. 3.
ILR 1. 2. 1. 1.
H 3. 3. 2. 2.
BL 5. 5. 6. 4.
BR 6. 5. 7. 5.
UN 0.097 0.056 0.119 0.097

Sequences

Field Description
UTR seq + 25 aaagcccgccuuucgugacaaauaaaggucguagccgcagagucaacgggcggagcuaaaguggucgugauucaugcugucgcgggaaccccgaagguggggccccacguaacaagaagATGACCCGAAGTTGCTCCGCAGTGG
UTR dot + 25 ……(((((((.((…..))))))).))…(((………)))(((((((……((((((..(((.((.((.((.(((..(((((….))))).))).)))).)).))).))))))…….)))))))…..
RS 1 seq GGUUUCCUUCGGGGCAGGGUGGAAUUCCCUACCGGCGGUGAUGAGCGUAUGCUCUCAGUCCGUGACCCGGCUAAUGGUUAUUAGACGGUGGAUUUGGUGAAACUCCAAAGCCGACAGUGAAAGUCUGGAUGGGAGAAGGACCGG
RS 1 dot …..((.((((…((((…….)))).)))).))(((.((((….)))))))((((….((((.(((((..(((((.(.((((…(((((…….))))))))).))))))..)).))).))))….))))…
RS 2 seq GCUCUUCCGGGCCCGUGGUGGACUGCCGGGGCCAAGUACGGCGGCCAGGGAGGAAGUCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUCACCGGGGUAGGUAGCCCCGGGAGCCAGGAACUCCCACCGCCGGUCUCGUCGAA
RS 2 dot ………(((((.((((…..))))))))).((..((((((…(((((….((((((…..(((((.((.(.((.(((.(((….)))))).))).)).))))).))).))).))))).))))))..))…….
RS 3 seq CCAGCCGUCGGAAACGGUGGUGACGGUGGACGGGGAGAAUCUGGGAAGCCGGUGAGAUUCCGGCACAGGCCCGCUGCGGUGAACCGAGCCUCCUCCACGGAGGACUCGGCAAGUCCGAAGACCGGCCUCCCGCCUGGCUUCUCC
RS 3 dot (((.((((((……….)))))))))………….((((((((((.(……(((…(((((.(((.(((….((((((((((…..))))).)))))…..))).)).).))))).)))))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table