Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108987 Similarity: 0.971 Similarity: 0.969 Similarity: 0.967
UTR: 5HSAA108987
Gene: THAP9_0
MFE: -42.216
ENS: 0.996
Length: 125.
Predicted Ligands:
cobalamin - 7/20
methionine - 4/20
SAM - 2/20
 RS: URS0002334EAC_394958
MFE: -30.526
Ligand: SAM
Species: Clostridium taeniosporum SAM riboswitch (S box leader)
 RS: URS0000C23E2C_1449350
MFE: -45.229
Ligand: SAM
Species: Roseivivax halodurans JCM 10272 SAM-I/IV variant riboswitch
 RS: URS0000C734A5_1223545
MFE: -47.925
Ligand: methionine
Species: Gordonia soli NBRC 108243 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108987 URS0002334EAC_394958 URS0000C23E2C_1449350 URS0000C734A5_1223545
Length 125. 125. 124. 124.
Similarity - 0.971 0.969 0.967
Ensemble Norm 0.996 - - -
MFE -42.216 -30.526 -45.229 -47.925
Ligands - SAM SAM methionine
Gene THAP9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.013 3.006 10.
Length SE - 0. 1. 1.
Lev Distance - 37. 39. 38.
UBS 10. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 4. 3. 3. 2.
ILR 1. 1. 2. 2.
H 2. 1. 2. 2.
BL 4. 4. 4. 2.
BR 6. 5. 5. 5.
UN 0.144 0.032 0.065 0.129

Sequences

Field Description
UTR seq + 25 aaauaaaggucguagccgcagagucaacgggcggagcuaaaguggucgugauucaugcugucgcgggaaccccgaagguggggccccacguaacaagaagATGACCCGAAGTTGCTCCGCAGTGG
UTR dot + 25 …….(((….)))………((..(((((((……((((((..(((.((.((.((.(((..(((((….))))).))).)))).)).))).))))))…….))))))).))..
RS 1 seq UACUUAUCAAGAGUGGUGGAGGGACUGGCCCUAUGAAGCCCAGCAACCUACUUUUAAGGUUAAUUAAUGUGUAAAUGCACAAAGUUUACUUUAAAUGUGUGGUGCCAAAUCCCGUUAGAUAAGAA
RS 1 dot ..((((((……..(((.((((.((((…………….((((((.((((((((.((((..(((((….))))).)))).)))))))).))).)))))))..)))).)))))))))..
RS 2 seq UUUGGGCAUCAAGAGAGGACGUGUCCUCGCCAACCUGCCGACCCGGCGAAGGUGGCUCCCUCCCCGGAGGAGAUGCGGGCAAGAAGGCCGCACCCCCAUUCGGCCGCCAACAAUCGGGUUCAUU
RS 2 dot ….((((….(.(((((….))))).)…..))))(((((((….((((((……..((((((.(.(((((.(…..).))))).).)).))))))))))…..)))))))….
RS 3 seq GGUCAUGAGUGUCAGCGUCAAGCCCCGGCUUGCUGAACGGCAACCCUCCAACCGCGGUGGGGUGCUCCGGGUGAUGACCAGGUUGUGGGGGUGCGUUCGCGUUCCUCCCCGGCAAGCGCGGGUC
RS 3 dot …………..((…..))((((((((((((((((((.(((((((((((..(((.(..((((…)))).).))).))))).))))))))…..)))))……))))))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table