Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA108988 Similarity: 0.950 Similarity: 0.949 Similarity: 0.948
UTR: 5HSAA108988
Gene: THAP9_1
MFE: -59.286
ENS: 0.905
Length: 178.
Predicted Ligands:
cobalamin - 6/20
Mn2+ - 5/20
FMN - 4/20
 RS: URS00023225FE_46433
MFE: -74.516
Ligand: cobalamin
Species: Reticulomyxa filosa Cobalamin riboswitch
 RS: URS0000C06658_1856861
MFE: -69.298
Ligand: Mg2+
Species: Mycobacterium sp. 1164966.3 M-box riboswitch (ykoK leader)
 RS: URS000232B5D6_1240085
MFE: -43.344
Ligand: cobalamin
Species: Anaerovibrio sp. JC8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA108988 URS00023225FE_46433 URS0000C06658_1856861 URS000232B5D6_1240085
Length 178. 177. 177. 179.
Similarity - 0.950 0.949 0.948
Ensemble Norm 0.905 - - -
MFE -59.286 -74.516 -69.298 -43.344
Ligands - cobalamin Mg2+ cobalamin
Gene THAP9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 19.002 8.001
Length SE - 1. 1. 1.
Lev Distance - 61. 55. 64.
UBS 16. 15. 15. 16.
BS 0. 0. 0. 0.
ILL 5. 5. 3. 6.
ILR 3. 4. 5. 4.
H 4. 3. 4. 2.
BL 6. 4. 5. 7.
BR 7. 6. 4. 6.
UN 0.039 0.073 0.085 0.073

Sequences

Field Description
UTR seq + 25 cuucggagaggaaguguggaagucccgcgccucuaaagcccgccuuucgugacaaauaaaggucguagccgcagagucaacgggcggagcuaaaguggucgugauucaugcugucgcgggaaccccgaagguggggccccacguaacaagaagATGACCCGAAGTTGCTCCGCAGTGG
UTR dot + 25 ((((…))))..((((((…..))))))((((…((.(((((((.((…..))))))).))..))…))))…((..(((((((……((((((..(((.((.((.((.(((..(((((….))))).))).)))).)).))).))))))…….))))))).))..
RS 1 seq UGCAGGUGUCCGUCCUGCCAUGGCUGCGACGGAUGAAACGGGAAGCCGGUGCAAGACCGGCGCUGCCCCCGCAACGGUAAGGCCUGGGCGUAUACGCCUCAGGCAUCGCGAUAACCACUGCCCAUACGGCGGGAAGGUGCGAUGCUGGCAUGGCCAAGCCCGGAGACCGGCCUGCGA
RS 1 dot …….((((((((.((….)).).)))))))…..(((..((((((…..))))))…..)))((((..(((..(((((((((……(((.(.((((((((….(((.(((((…..)))))…))))))))))).)…)))…)))))).).)).))))))).
RS 2 seq UAUGCACCUCGCUAGGUGAGGCGUCUACACGGAUACAGGCCACUGACCUCGAACGUCGAGAGACGCCCAGGGUCAGGACAGCUCCUCCCGGCUGAAGGGUUGAGCCCAAGUGGCUUCCGGUUGCGAUCCAACCGGAUACGCCGUGUGGUGCCAAAGCUCUGACGAGAGGGGUGCCGU
RS 2 dot ….(((((….))))).(((((((….))))….))).(((((((.(..((((….))))..).)))))))….(((((((.((.(…(((((((.(((((..((((.((((((((…..))))))))…))))..))).))))..)))))).)).)))))))…..
RS 3 seq UAAAAAAAUAACGGAUUAGGCGUCAUAGUACUUAAUAGAAAAGCCGGUUUAAGGCCGGCGCGGUCACGCCACUGUAUCGGGGAGCGAAUCUGCAAGAAAUGUCACUGGGGGAGACUCUGGGAAGGCGCGGAGGAGCUGUGAACCGGAGCCAGGAGAACUGCCUGAUUAACAAUCACCGU
RS 3 dot ……….((((….(((((.((.((………….(((((((…))))))))).)).))))).))))..(((.((..(((((.((.((…(.((.((((……((((((…..(((((…..)))))..)))))))))))).).))))..))))..)..)).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table