Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109247 Similarity: 0.991 Similarity: 0.991 Similarity: 0.990
UTR: 5HSAA109247
Gene: THRSP
MFE: -8.643
ENS: 0.861
Length: 46.
Predicted Ligands:
SAM - 8/20
preQ_1 - 6/20
unknown - 4/20
 RS: URS0000ABCB80_1002809
MFE: -7.436
Ligand: preQ_1
Species: Solibacillus silvestris StLB046 PreQ1 riboswitch
 RS: URS0000D681E7_36809
MFE: -8.726
Ligand: unknown
Species: Mycobacterium abscessus DUF1646 RNA
 RS: URS0000AB5458_649639
MFE: -5.984
Ligand: preQ_1
Species: Bacillus cellulosilyticus DSM 2522 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109247 URS0000ABCB80_1002809 URS0000D681E7_36809 URS0000AB5458_649639
Length 46. 45. 48. 45.
Similarity - 0.991 0.991 0.990
Ensemble Norm 0.861 - - -
MFE -8.643 -7.436 -8.726 -5.984
Ligands - preQ_1 unknown preQ_1
Gene THRSP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 3.003 6.002
Length SE - 1. 4. 1.
Lev Distance - 10. 7. 10.
UBS 4. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 1. 1. 0. 0.
H 2. 2. 2. 2.
BL 2. 1. 1. 2.
BR 1. 0. 2. 3.
UN 0.152 0.089 0.208 0.111

Sequences

Field Description
UTR seq + 25 auugugucagaggaagcaaccATGCAGGTGCTAACCAAGCGTTACC
UTR dot + 25 .((((.((….)).))))..((((.(((….)))..))))….
RS 1 seq CUUUGCGUGGUUCGUAACCAUCCCACGUUAAAAAACUAGGAGGAA
RS 1 dot ..(((((…..)))))((.(((…(((….)))..)))))..
RS 2 seq GGUUGGGCGAAAGCUUCAAGGAUUCAGUUCUUCAAGGGGUGAGAAGAA
RS 2 dot ..((((((….))).)))…((((.((((…)))).))))…..
RS 3 seq GCAGCAGAGGUUCUAGCUACACCCUCUAUAAAAAACUAAGGAGAC
RS 3 dot (.((((((…))).))).)…((((.((……)).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table