Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109440 Similarity: 0.985 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA109440
Gene: TIGIT
MFE: -26.043
ENS: 0.972
Length: 94.
Predicted Ligands:
TPP - 14/20
SAM - 4/20
GMP - 1/20
 RS: URS00019AC9BC_2653134
MFE: -19.199
Ligand: TPP
Species: Chryseobacterium sp. 8AT TPP
 RS: URS0000C3EC0C_1664318
MFE: -22.699
Ligand: TPP
Species: Chryseobacterium sp. MOF25P TPP riboswitch (THI element)
 RS: URS0000C193C1_880074
MFE: -18.221
Ligand: TPP
Species: Barnesiella viscericola DSM 18177 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109440 URS00019AC9BC_2653134 URS0000C3EC0C_1664318 URS0000C193C1_880074
Length 94. 94. 94. 93.
Similarity - 0.985 0.983 0.983
Ensemble Norm 0.972 - - -
MFE -26.043 -19.199 -22.699 -18.221
Ligands - TPP TPP TPP
Gene TIGIT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.004 6.004 16.004
Length SE - 0. 0. 1.
Lev Distance - 19. 21. 17.
UBS 5. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 2. 2. 3.
H 3. 2. 2. 2.
BL 1. 1. 1. 0.
BR 2. 1. 1. 0.
UN 0.277 0.213 0.213 0.215

Sequences

Field Description
UTR seq + 25 cuacgaaaauaacaagcuggccaugaagcuacauagcagaauaugcgagggggcaacgugcuaaguugaATGCGCTGGTGTCTCCTCCTGATCT
UTR dot + 25 …………..((((……..))))…..(((…..)))(((((((((.(((((……….)))).).)))))))))…….
RS 1 seq GCUGAAAUAAAGGGGUGCUCCAAAGCGGGCUGAGAUUAUACCCAAUGAACCUGGAACGGGUAAUGCUGUUUAGGGAAACAUUCAUUAUAAUUGA
RS 1 dot …………((((((((……))))………))))(((((((((.((((((……)))))).)))…..))))))……..
RS 2 seq GCUGAAAUAAAGGGGUGCUCCAAUAGGGGCUGAGAUUAUACCCAAUGAACCUGGAACGGGUAAUGCUGUUUAGGGAAACAUUCAUUAUAAUUGA
RS 2 dot …………(((((((((….)))))………))))(((((((((.((((((……)))))).)))…..))))))……..
RS 3 seq UAAGUAACAAAGGGGUGCCUAAAAACGGCUGAGAUCAUACCCUAUGAACCUGAUACGGAUAAUGCCGGCGCAGGAAUUGUUCAUAGUCCUAUC
RS 3 dot ………….((((((…….)))………)))(((((((((((…(((……)))…))))…..)))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table