Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109442 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA109442
Gene: TIMD4
MFE: -24.292
ENS: 0.878
Length: 82.
Predicted Ligands:
zmp-ztp - 8/20
SAM - 5/20
cyclic-di-GMP - 4/20
 RS: URS0000AB7841_702450
MFE: -14.909
Ligand: cyclic-di-GMP
Species: Turicibacter sanguinis PC909 Cyclic di-GMP-II riboswitch
 RS: URS0000C736A9_1423744
MFE: -16.866
Ligand: SAM
Species: Lactobacillus floricola DSM 23037 = JCM 16512 SMK box translational riboswitch (SAM-III)
 RS: URS0000C4B961_1640513
MFE: -26.176
Ligand: cyclic-di-GMP
Species: Chloroflexi bacterium CSP1-4 Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109442 URS0000AB7841_702450 URS0000C736A9_1423744 URS0000C4B961_1640513
Length 82. 82. 81. 83.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.878 - - -
MFE -24.292 -14.909 -16.866 -26.176
Ligands - cyclic-di-GMP SAM cyclic-di-GMP
Gene TIMD4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 9. 4.
Length SE - 0. 1. 1.
Lev Distance - 19. 19. 21.
UBS 5. 4. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 3. 1.
ILR 3. 3. 4. 4.
H 1. 1. 1. 1.
BL 2. 0. 0. 3.
BR 0. 0. 0. 1.
UN 0.134 0.146 0.136 0.133

Sequences

Field Description
UTR seq + 25 auaagagguugggcuuuggauagauagacagacuccuggguccggucaaccgucaaaATGTCCAAAGAACCTCTCATTCTCT
UTR dot + 25 …(((((((…((((((((((((.(((.((((….))))..)))….)))….))))))))))))))))……..
RS 1 seq UUCUGCCUAAGAAUCGAUGAAAUAUAUUCUGUAUAUGGGUACCUGGAAUAUAUCGAGAUAUUGGUACAACCGGCUUUUUAAA
RS 1 dot ….(((…..(((((((..(((((((((((((….))))..)))))))))…..)))))))……)))……..
RS 2 seq GAUUCUUACUUGUGUUCCCGAUAGGAUCUAGUUAAAUACUAGAUAUGCCUUGUAACCGAAUCGAAGGGGGAAAUAAAAAUG
RS 2 dot ..((((..(((..((((…((((((((((((…..)))))))….)))))….))))..)))..))))………
RS 3 seq AAGACGCUCGGACGCGCUGACACCCCACCUGAAAUGGGCACUUAGGGCGGGGUUGAGCGACUAGUGCAACCGACCGACGAAUC
RS 3 dot ….((.((((..((((((.((((((.(((((………)))))..)))))…..)..))))))..)))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table