Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109525 Similarity: 0.955 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA109525
Gene: TINAG
MFE: -28.908
ENS: 0.892
Length: 171.
Predicted Ligands:
cobalamin - 8/20
Mg2+ - 6/20
lysine - 5/20
 RS: URS0000C8A42C_748449
MFE: -33.397
Ligand: lysine
Species: Halobacteroides halobius DSM 5150 Lysine riboswitch
 RS: URS0000C08456_1827365
MFE: -57.384
Ligand: lysine
Species: Rheinheimera sp. SA_1 Lysine riboswitch
 RS: URS0000C32436_1423750
MFE: -32.
Ligand: Mg2+
Species: Lactobacillus ghanensis DSM 18630 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109525 URS0000C8A42C_748449 URS0000C08456_1827365 URS0000C32436_1423750
Length 171. 171. 172. 171.
Similarity - 0.955 0.951 0.951
Ensemble Norm 0.892 - - -
MFE -28.908 -33.397 -57.384 -32.
Ligands - lysine lysine Mg2+
Gene TINAG - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 15.002 11.
Length SE - 0. 1. 0.
Lev Distance - 59. 57. 61.
UBS 11. 12. 13. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 4.
ILR 4. 5. 5. 4.
H 2. 2. 1. 1.
BL 4. 4. 6. 5.
BR 4. 5. 2. 6.
UN 0.053 0.082 0.012 0.058

Sequences

Field Description
UTR seq + 25 gaaguauacucauucaaguaaaggaucaguuucaggguucaggcugaagugucuuaaugacuagaauucagguuccaaggagaagcccacaaggcuaaggguauuggauauaacggaaaguggaagcuauaccugacuuccagagaATGTGGACCGGATATAAGATCTTAA
UTR dot + 25 ……((((……)))).((((((.((.((..((((((.((((……………..(((.(((((((((((…..((((…..))))…….)))))………………….)))))).))))))….).)))))).)).))..))))))..
RS 1 seq UAGAAUGAUAGAGGAGCAAUGAUUAUUAGUACUUCUAAGGAGCUAGGUCUGAGUGUAGAAUUAGGAGGAAAGGGAUUAUUGCCGAAGCCCUAAAAGCAAUUGCUAUCUCUUAGGGUUGGGGAUAUAAUUAAUAGUUAUAUUACUGCCACUUUGUGGAGAGCUAUCUUACGA
RS 1 dot ……..((((((.(((((….))).)).))))))..(((.(((.(((((((((((……………((((((..((..((((((((.(((….)))…..))))))))..))..))))))………….)))).))))…..))).))).)))….
RS 2 seq UAGACCAGAAGAGGAGCGUUCACCAGGUAGUUCAGCGCAGGUUGCUAUAAACCGGAUACUGAAUGAGGGGGAUGAACGCCGAGGAUGUUACGUCGUAGCAGCGUAACGUCCGGUCAAAAGGGCUGAAUCCCUGCGACUGUCACCUGAAACCCGGUGGAGAGCUUCUGGCCUU
RS 2 dot .((.(((((…..(((.((((((.(((..(((((.(((.(((((………………….((((((..(.((((((((((((((((…….)))))))))))..))…..))))..))))))))))))))…)))))))).))))))..)))))))).)).
RS 3 seq AAGUAGAUUUGUUAGGUGAGGCUCCUAUAUAAACAUAGGCUGCUGCCAAAAAAACGUCGAGAGACACCAAUUGGUAGAACAGGGAUUGUCGAUACAAGGCUUUCUUUAAAGCAGCUAAAAGAUAUUCUUUUUACGUUAUAUAGUGCCAAAACUCAACGAAUAAAUCGUUAA
RS 3 dot …..((((((((.(.((((((..((((((.(((.((((((((((((……..(((((.((…((..(((……))))).)).)))))….)))………)))))))……………)).))))))))).)))…..))).).))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table