Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109850 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA109850
Gene: TM4SF20
MFE: -10.181
ENS: 0.808
Length: 63.
Predicted Ligands:
fluoride - 11/20
unknown - 6/20
cobalamin - 1/20
 RS: URS0000DA10E3_581103
MFE: -15.537
Ligand: fluoride
Species: Geobacillus sp. Y4.1MC1 Fluoride riboswitch
 RS: URS0000D785B0_1797236
MFE: -16.666
Ligand: fluoride
Species: Alicyclobacillus sp. RIFOXYA1_FULL_53_8 Fluoride riboswitch
 RS: URS0000E600C1_1943632
MFE: -16.961
Ligand: unknown
Species: Pseudomonas sp. Bc-h nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109850 URS0000DA10E3_581103 URS0000D785B0_1797236 URS0000E600C1_1943632
Length 63. 62. 63. 62.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.808 - - -
MFE -10.181 -15.537 -16.666 -16.961
Ligands - fluoride fluoride unknown
Gene TM4SF20 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.010 5.001 2.
Length SE - 1. 0. 1.
Lev Distance - 14. 16. 16.
UBS 5. 4. 4. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 1.
ILR 1. 2. 0. 1.
H 1. 1. 1. 2.
BL 1. 0. 0. 1.
BR 1. 1. 0. 1.
UN 0.127 0.226 0.095 0.145

Sequences

Field Description
UTR seq + 25 auagccacuuugacaacguuucugagccaggggugaccATGACCTGCTGCGAAGGATGGACAT
UTR dot + 25 ….(((…………((((..(.(((((((…….)))).))))..)))))))….
RS 1 seq UUAAAAUUAGGCGAUGGGGUUCGCCGUAAUUGCCUUUUAUGGCUGAUGACUCCUACCAGUAA
RS 1 dot ………((….((((((((((((((…….))))))).))..)))))..))…..
RS 2 seq AAUUGCAUCGGUGAUGGAGCUCACCAUUAAACUCCUGCAAAGGAUAAUGGCUCCUGCGAAUAG
RS 2 dot ..(((((……..(((((….(((((…((((….)))))))))))))))))))….
RS 3 seq GGGUGCGUUGUUGCAUACGGCACUGCGCAGGUUAAAUUCAAACGUUGGUCGGGCCGCCAUCG
RS 3 dot ..(((((….))))).((((.(((..((((((…….))).)))..)))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table