Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109901 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA109901
Gene: TM9SF4
MFE: -10.225
ENS: 0.719
Length: 52.
Predicted Ligands:
unknown - 9/20
glutamine - 8/20
SAM - 3/20
 RS: URS0000E6042B_1736436
MFE: -26.476
Ligand: unknown
Species: Afipia sp. Root123D2 sul1 RNA
 RS: URS0000C2BFF1_12908
MFE: -7.816
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C6A532_12908
MFE: -9.622
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109901 URS0000E6042B_1736436 URS0000C2BFF1_12908 URS0000C6A532_12908
Length 52. 53. 53. 52.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.719 - - -
MFE -10.225 -26.476 -7.816 -9.622
Ligands - unknown glutamine glutamine
Gene TM9SF4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.004 3.019 1.001
Length SE - 1. 1. 0.
Lev Distance - 11. 11. 13.
UBS 2. 2. 3. 2.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 0. 0. 1. 0.
BR 0. 0. 1. 0.
UN 0.288 0.226 0.151 0.327

Sequences

Field Description
UTR seq + 25 gucauuacggcgacacguggauccaagATGTGTGAAACAAGCGCCTTCTATG
UTR dot + 25 ……..((((((((((………))))))……..))))…….
RS 1 seq GUCGGACCCGGCUCGCCGGGUGGCUCCGCCCGGCGCCUAUCCCCGGGACAACC
RS 1 dot ……(((((..(((((((((….)))))))))…….)))))……
RS 2 seq AUCGUUCAACUUCUUAGGAAGUCGGAAGUAGGUGAAAACUGAAGGAACGCGCC
RS 2 dot .((.((((((((((………))))))……….)))).))…….
RS 3 seq AUCGUUCAACUCUUUUAGAGUCGGAAGUAAGCGAAAGCUGAAGGAACGCAAC
RS 3 dot ……….((((((((..(((……..)))…))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table