Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA109915 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA109915
Gene: TMBIM4
MFE: -51.335
ENS: 0.718
Length: 101.
Predicted Ligands:
TPP - 12/20
purine - 4/20
SAM - 1/20
 RS: URS0000D8671B_1882821
MFE: -35.985
Ligand: TPP
Species: Rhodovulum sp. ES.010 TPP riboswitch (THI element)
 RS: URS0000C10C78_411922
MFE: -24.802
Ligand: purine
Species: Sporomusa sp. An4 Purine riboswitch
 RS: URS0000D87348_1155944
MFE: -26.991
Ligand: SAM
Species: Marininema halotolerans SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA109915 URS0000D8671B_1882821 URS0000C10C78_411922 URS0000D87348_1155944
Length 101. 103. 102. 102.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.718 - - -
MFE -51.335 -35.985 -24.802 -26.991
Ligands - TPP purine SAM
Gene TMBIM4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.016 6. 6.005
Length SE - 4. 1. 1.
Lev Distance - 27. 30. 30.
UBS 9. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 2. 2. 2. 3.
BR 4. 4. 2. 2.
UN 0.010 0.136 0.029 0.078

Sequences

Field Description
UTR seq + 25 gggcucuuccucgcggaaguggggaggaggcgguugcgguuaguggaccgggaccgguaggggugcuguugccaucATGGCTGACCCCGACCCCCGGTACC
UTR dot + 25 .(.(((((((((((….))))))))))).)((((.(((((….))))).))))((((((((((..(((((((…)))).)))..).)))))…))))
RS 1 seq CGGCUUACCUCGGGGUGCCCCAUGGGGCUGAGAUGCGCGCCUGCGCGAACCCGUCGAACCUGACCCGGUUAGAACCGGCGGAGGGAAGGUCCAUGGAGAACAU
RS 1 dot …((((((((((((…))).))))).)))).(((((….)))))…((((.((.(((..((((((….))))).)..)))….)).))))…….
RS 2 seq UACAAAUAAAUACAUAAUGCUCGUAUAUAUUUGAGGAUAUGGCUCAAAAGUUUCUACCAGGCGACCGUAAAUCGCCCGACUACGGGUGAAAGUGUGCCUAGG
RS 2 dot ..((((((.((((………)))).))))))((((..(……..)..)))).((((((.((……(((((((….)))))))….)))))).))
RS 3 seq AUCUUAUCGGUGGAGGGAAAUGACCCGAUGAAGCCUGGCGACUUGUGAAGGAACAUAAGGCGCUUAGUCCAGCAAAAUGAUUUUCAUUUUGGAAGAUGGGGU
RS 3 dot …(((((((.(..(…..)..))))))))…((((((.((((((……)))))).)))).))((((.((((((((…))))))))…..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table