Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110298 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA110298
Gene: TMEM101
MFE: -10.123
ENS: 0.821
Length: 50.
Predicted Ligands:
unknown - 15/20
SAM - 4/20
Ni/Co - 1/20
 RS: URS0000E60903_1805288
MFE: -20.504
Ligand: unknown
Species: Candidatus Omnitrophica bacterium CG1_02_46_14 nhaA-I RNA
 RS: URS0000E6097A_1801871
MFE: -19.135
Ligand: unknown
Species: Omnitrophica WOR_2 bacterium RIFCSPLOWO2_12_FULL_63_16 nhaA-I RNA
 RS: URS00021EE029_396013
MFE: -17.570
Ligand: Ni/Co
Species: Pseudooceanicola marinus SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110298 URS0000E60903_1805288 URS0000E6097A_1801871 URS00021EE029_396013
Length 50. 50. 50. 49.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.821 - - -
MFE -10.123 -20.504 -19.135 -17.570
Ligands - unknown unknown Ni/Co
Gene TMEM101 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 7.026 3.003
Length SE - 0. 0. 1.
Lev Distance - 16. 15. 17.
UBS 4. 3. 2. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 0. 0. 0. 1.
H 3. 3. 2. 2.
BL 0. 0. 0. 1.
BR 1. 0. 0. 1.
UN 0.140 0.080 0. 0.082

Sequences

Field Description
UTR seq + 25 ccgcagcggacugcccuuucccaagATGGCGTCGAAGATAGGTTCGAGAC
UTR dot + 25 ..((((….))))((..((….)).))..(((((……)))))…
RS 1 seq GGGUCUAGGUUCUUUGCCUAGAGGAAACUCCGGUGGUCGGGCCGCCACCA
RS 1 dot …(((((((…..)))))))(((…)))((((((……)))))).
RS 2 seq GGGUCCGGGUAUAUCGCCCGGAGGAGUUUCUAGUGGUCGGGCCGCCACCU
RS 2 dot …(((((((…..)))))))……….(((((……)))))..
RS 3 seq CCGCCCCAACGGCUUCCUGACGGGGCAGGUCUGAACUUUUACCGGAGCA
RS 3 dot ..(((((..(((….)))..))))).(.((((………)))).).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table