Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110421 Similarity: 0.977 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA110421
Gene: TMEM117
MFE: -22.223
ENS: 0.998
Length: 91.
Predicted Ligands:
TPP - 8/20
glycine - 4/20
GMP - 3/20
 RS: URS0000C3340A_348151
MFE: -24.174
Ligand: TPP
Species: Lactobacillus siliginis TPP riboswitch (THI element)
 RS: URS00023139CD_1357508
MFE: -21.923
Ligand: cobalamin
Species: Nostoc calcicola FACHB-389 AdoCbl variant RNA
 RS: URS0000D66D8A_12908
MFE: -32.309
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110421 URS0000C3340A_348151 URS00023139CD_1357508 URS0000D66D8A_12908
Length 91. 90. 90. 90.
Similarity - 0.977 0.976 0.976
Ensemble Norm 0.998 - - -
MFE -22.223 -24.174 -21.923 -32.309
Ligands - TPP cobalamin GMP
Gene TMEM117 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 9.006 2.001
Length SE - 1. 1. 1.
Lev Distance - 29. 27. 30.
UBS 8. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 1. 0. 1. 1.
H 3. 3. 3. 2.
BL 3. 3. 1. 3.
BR 2. 3. 1. 3.
UN 0.121 0.167 0. 0.144

Sequences

Field Description
UTR seq + 25 ccgugugcagucgccccgcgccccgcgcgacccuucggguaaacuacgaacugggaguucugaagaATGGGTAAAGACTTTCGTTACTATT
UTR dot + 25 .((((((..(.(((…))))..))))))…(((((((…(((.(……).))))))))))….(((((.((…)).)))))…
RS 1 seq AAAAUAUAUCUGGGGUGCCUAGCGGCUGAGAUAAAACCCAUUGAACCUGAUUCGGUUAGUACCGACGAAGGGAGAUACGUAAGUGUGGUU
RS 1 dot ……(((((.((.(((…))).)).)))))…(((.(((……..(((((….)))))))).)))..((((….))))….
RS 2 seq CUAAAACUUGGGGUUGGGAAACUCCGGUGAAAUUCCGGGACUGUGCCGCAACUGUGAUGGGAUUGCCUAAGUCAGAAUGCCAAUUCUCAG
RS 2 dot ………((((((….))))))(((..(((((((..((.((……)).))..))))))))))……(((((….)))))…
RS 3 seq UGGUGGGGUAGAGGCUAGGAACCGCGUCCCGCAAGGUCGGGCACCUAUUAGGGCGCGGGGGAGCCAGUGGUGCGACCGGCUACCGUAACC
RS 3 dot ..((((((..(.((…….)).).))))))..(((((((((((.(((..(((.(….).)))))))))))..))))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table