Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110552 Similarity: 0.968 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA110552
Gene: TMEM139
MFE: -32.139
ENS: 0.987
Length: 133.
Predicted Ligands:
TPP - 7/20
SAM - 7/20
FMN - 3/20
 RS: URS0000C5F9CE_1610491
MFE: -61.048
Ligand: TPP
Species: Lampropedia cohaerens TPP riboswitch (THI element)
 RS: URS0000D88ABD_1977292
MFE: -38.112
Ligand: TPP
Species: Bacillus xerothermodurans TPP riboswitch (THI element)
 RS: URS0000C1C295_1850246
MFE: -26.999
Ligand: SAM
Species: Lutibacter sp. LPB0138 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110552 URS0000C5F9CE_1610491 URS0000D88ABD_1977292 URS0000C1C295_1850246
Length 133. 132. 133. 133.
Similarity - 0.968 0.967 0.966
Ensemble Norm 0.987 - - -
MFE -32.139 -61.048 -38.112 -26.999
Ligands - TPP TPP SAM
Gene TMEM139 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.004 8. 4.013
Length SE - 1. 0. 0.
Lev Distance - 38. 42. 44.
UBS 8. 8. 9. 7.
BS 0. 1. 0. 0.
ILL 1. 1. 0. 0.
ILR 3. 1. 2. 2.
H 4. 4. 4. 4.
BL 1. 2. 2. 1.
BR 1. 3. 3. 0.
UN 0.211 0.144 0.211 0.323

Sequences

Field Description
UTR seq + 25 augaaagugauaaucaggcagcccaaaugauuguuaauaaggaucaaaugagaucguguauguggguccaaucaauugauucuacacaaaggagccuggggaggggccATGGTGCCAATGCACTTACTGGGGA
UTR dot + 25 …….(((((((((((….))…)))))))))…((((((((.(((((((………))))…))).))))))))…….((..(((….)))..))..(((((….)))))………
RS 1 seq UGCGUCACCGAGGGGAGUCCCGCCAAGGGGCUGAGAGACUGAUGGGCGGCGCCGCUGUGGGCGCCGCCGGUGCAGUGACCCUUUGAACCUGAUCCGGAUCAUGCCGGCGCAGGGACGGACCGAUUCCAUCGC
RS 1 dot ……..(((((((((((((…..))))))…..((((((.(((((((((……))))))))).)).))))..)))))))..((((..((((……))))..))))((.(((…..))).))..
RS 2 seq AAUAGCCACUAGGGGAGCCUCACCAUGCGAGGCUGAGAGAAGGACGCUUAGUUCCUUGACCCUUGGAACCUGAUUGGCGUGCUAGCACUUGCUUCUGGAUUAUACCAGCGUAGGGAAGUGGACGGAUGUAAAA
RS 2 dot …..((….))..((((((…….))))))……((.((((((((((((………))))).))…))))).))..(((((.(((((((……))))…))).)))))………….
RS 3 seq AUGUUAUAGUGAAAGGCCGAGGGAAUAGACCCUUUGAAGCCUUAGCAACCCUUUAUUCGUAAAGAAGGUGCUAAAUUCUACUGUUUAUACUGGAUUUAUUCAGUACCUGUAAUAAGGAACAGAAAGAUAACAC
RS 3 dot …………..(((((((((…….))))))..)))(((((.((((((((….)))))..))))))))………….(((((((….)))))))(((……)))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table