Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110879 Similarity: 0.977 Similarity: 0.974 Similarity: 0.971
UTR: 5HSAA110879
Gene: TMEM196
MFE: -19.280
ENS: 0.759
Length: 110.
Predicted Ligands:
TPP - 15/20
SAM - 2/20
cobalamin - 1/20
 RS: URS0000C1E619_1262767
MFE: -19.204
Ligand: TPP
Species: Catenibacterium sp. CAG:290 TPP riboswitch (THI element)
 RS: URS0000C1D6FD_97138
MFE: -23.295
Ligand: TPP
Species: Clostridium sp. ASF356 TPP riboswitch (THI element)
 RS: URS0000D8FC30_28066
MFE: -32.975
Ligand: TPP
Species: Rhodoferax fermentans TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110879 URS0000C1E619_1262767 URS0000C1D6FD_97138 URS0000D8FC30_28066
Length 110. 110. 110. 110.
Similarity - 0.977 0.974 0.971
Ensemble Norm 0.759 - - -
MFE -19.280 -19.204 -23.295 -32.975
Ligands - TPP TPP TPP
Gene TMEM196 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 11. 15.001
Length SE - 0. 0. 0.
Lev Distance - 30. 30. 32.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 4. 4. 2. 2.
ILR 4. 3. 3. 3.
H 2. 2. 2. 2.
BL 2. 2. 4. 5.
BR 3. 3. 2. 4.
UN 0.136 0.164 0.145 0.

Sequences

Field Description
UTR seq + 25 ggaagggguaaggaggauaguggaagaaaaaaagguagaugguugauuucccucucugaucuggaaggaagaugaccgaggaaggATGTGCACCAGCGGTCAGATTATTG
UTR dot + 25 …..((((.((((((..(((.((………………)).)))..)))).)).))))……((..((((((..(..(……)..)..))))))..))….
RS 1 seq CAAAUAAAAAAGGGGAGCUGACGCGACGGCUGAGAAGAAAUACGAUCGGAUUUCGACCCAUAAAACCUGAUACGGAUAAUGCCGGCGUAGGAAUUUUGUUUUUUAGGUAU
RS 1 dot ………..(((..(..((..(((((…………..)).)))..)).)..)))…..((((((.(((((..((.((……)).)))))))…))))))..
RS 2 seq AAAUGUUGCUAGGGGUGCCAAUGUGGUAUUGGCUGAGAAUAAAACGAAUGUUUUGUACCCUUAAACCUGAACUAGAUAAUGCUAGCGGAGGGAAGCGGUUUAGUGCAAAA
RS 2 dot ………(((((((((.(((((.((.(((……..))).))..)))))..)))))))))….((.(((((((..((((..(….)..))))))))))).))…
RS 3 seq ACAGGCUUGUCGGGGCGCCAGAGACGAAAGUCGAGGCUGAGACCACUUCUGUGGAACCCGCUGAACCUGAUCGGGGUCAUGCCCGCGUAGGGAACAACGCAAUUGGCAUC
RS 3 dot .((((.(((.((((…(((.(((…..(((……..)))….))).)))..)))).))).))))………(((((.((((.(….).))))….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table