Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110907 Similarity: 0.973 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA110907
Gene: TMEM200A
MFE: -19.362
ENS: 0.903
Length: 120.
Predicted Ligands:
SAM - 11/20
guanidine - 3/20
glycine - 2/20
 RS: URS0000C38B2D_1635257
MFE: -34.087
Ligand: guanidine
Species: Halomonas sp. 54_146 Guanidine-I riboswitch
 RS: URS0000C391F4_1574623
MFE: -31.774
Ligand: SAM
Species: Lyngbya confervoides BDU141951 SAM riboswitch (S box leader)
 RS: URS0000ABAD2F_402881
MFE: -48.933
Ligand: guanidine
Species: Parvibaculum lavamentivorans DS-1 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110907 URS0000C38B2D_1635257 URS0000C391F4_1574623 URS0000ABAD2F_402881
Length 120. 121. 119. 119.
Similarity - 0.973 0.972 0.971
Ensemble Norm 0.903 - - -
MFE -19.362 -34.087 -31.774 -48.933
Ligands - guanidine SAM guanidine
Gene TMEM200A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 1.005 5.
Length SE - 1. 1. 1.
Lev Distance - 34. 36. 36.
UBS 7. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 2. 2. 2.
H 3. 3. 3. 3.
BL 3. 3. 3. 2.
BR 2. 3. 2. 0.
UN 0.192 0.149 0.261 0.185

Sequences

Field Description
UTR seq + 25 gugaagucaugcuaagaaagaacagaucucaaaaauggucucuucagagggaaugauuauucgaaacaacuaauuugagaguaaaaggccaagcuATGATAGCAACTGGTGGAGTGATAA
UTR dot + 25 ….((((((.((……(((.(((((……..))))).)))….)).)))))).((((((……..))))))……..((((.((((…))))…))))……….
RS 1 seq CCAAUAGAUCGCUAGGGUUCCGACACCAUCAAUGAUAUUGCCCUGAUGGCUGUGGCUGGUCCGAGAGCAAUCGACCUUGCAAGCACGCAAGGUUACACGGCGGGAUAAAAGCCCGGGAGGA
RS 1 dot ……(((.(((.(((…(.(((((((((…………)))))).))).)….)))…))).)))((((((((……))))))))……((((…….))))……
RS 2 seq AUUUUAUGAAGAAGGGUGGAGAGAUCGGGCUCUGUGAAACCCUGGCAACCGCACGAAAGUGAAAGGUGCCAAUUCCCGCCAAAAAAUGUUGCCCCUGGCAGCGAUUGGAAAAAUAAAAU
RS 2 dot ………….(((((.((((……)))).)…))))((((.(((.(((….)))…)))))))…….((((….(((((((…))))))).))))………..
RS 3 seq GUUGGCAGCGGCUAGGGUUCCGGCUUCGCGUGUAGUUGUUUGCGAAGUGCUGGUCCGAGAGCCGCACCCUGUCCGGUGAACAGCGGGCAGGUACACGGCGGGACAAAAGCCCGGGAGAC
RS 3 dot …….((((((.(((..(((((((((((……….))))))..))))))))…))))))..((((((((……..))))))))…….((((.(….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table