Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110919 Similarity: 0.979 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA110919
Gene: TMEM205
MFE: -34.554
ENS: 0.908
Length: 95.
Predicted Ligands:
glycine - 10/20
TPP - 8/20
guanidine - 1/20
 RS: URS0000C650C0_1856866
MFE: -31.292
Ligand: glycine
Species: Mycobacterium sp. 852002-51759_SCH5129042 Glycine riboswitch
 RS: URS0000AB1E9E_1263105
MFE: -24.014
Ligand: glycine
Species: Roseburia inulinivorans CAG:15 Glycine riboswitch
 RS: URS0000C284E0_1509407
MFE: -17.385
Ligand: TPP
Species: Aspergillus nomius NRRL 13137 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110919 URS0000C650C0_1856866 URS0000AB1E9E_1263105 URS0000C284E0_1509407
Length 95. 96. 96. 94.
Similarity - 0.979 0.979 0.979
Ensemble Norm 0.908 - - -
MFE -34.554 -31.292 -24.014 -17.385
Ligands - glycine glycine TPP
Gene TMEM205 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 4.005 2.009
Length SE - 1. 1. 1.
Lev Distance - 26. 26. 27.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 1.
H 2. 3. 3. 3.
BL 3. 2. 4. 3.
BR 4. 4. 4. 3.
UN 0.063 0.104 0.135 0.160

Sequences

Field Description
UTR seq + 25 gaaacccacgaggggacgcggccgaggagggucgcuguccacccgggggcgugggagugaggacugcaagATGGAGGAAGGCGGGAACCTAGGAG
UTR dot + 25 ….(((.((.((((((((((((……)))))).)))).)))).)))(.((((……..((((………….))))…)))).)..
RS 1 seq CGCCGCCGUGCGGGAGAGUUCCGGGUUUCGUCCCGGACGCCGAAGGAGCAGCACCUCCCCGUCAAUCUCUCAGGCAUCAGGGACCGUACGGAGUUC
RS 1 dot …((.(((.((((((((……..))).))))).))).))..((((……))))(((((..(((((……..)))))..).))))…..
RS 2 seq GAUCGACUCUCUGGAGACACCCGGAUGAACCGGGGGCCGAAGGUGCAACAUACGUUUUCGUAUGAAUCUCUCAGGCAAGCGGACAGAGAAGAUAUC
RS 2 dot …..(((.((.((…(.(((((…..)))))).)))).)))….((((((….)))))).(((((((.(………).)))).)))…
RS 3 seq ACAUGGCAUCGAUGGACUGGGUUCGUUCUGAGAUUAUACGGCUAAAACUUGAUCUGGAUAAUACCAGCGAAAAGGAUCAUGCCUUCCCUCGUCC
RS 3 dot …((((..((((((.((.((……)).)).)))).))))))………((((……))))(((.((((……))))…)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table