Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110920 Similarity: 0.962 Similarity: 0.962 Similarity: 0.959
UTR: 5HSAA110920
Gene: TMEM205_0
MFE: -64.273
ENS: 0.883
Length: 154.
Predicted Ligands:
FMN - 7/20
glucosamine - 6/20
cobalamin - 3/20
 RS: URS0000C07A01_1437610
MFE: -48.901
Ligand: FMN
Species: Bifidobacterium reuteri DSM 23975 FMN riboswitch (RFN element)
 RS: URS0000DABCA3_1897043
MFE: -47.217
Ligand: glucosamine
Species: Clostridiales bacterium 41_12_two_minus glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C81405_1262875
MFE: -45.599
Ligand: FMN
Species: Eggerthella sp. CAG:209 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110920 URS0000C07A01_1437610 URS0000DABCA3_1897043 URS0000C81405_1262875
Length 154. 153. 153. 154.
Similarity - 0.962 0.962 0.959
Ensemble Norm 0.883 - - -
MFE -64.273 -48.901 -47.217 -45.599
Ligands - FMN glucosamine FMN
Gene TMEM205 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3.003 16.002
Length SE - 1. 1. 0.
Lev Distance - 47. 49. 48.
UBS 11. 10. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 2. 2. 2. 3.
H 3. 4. 3. 5.
BL 1. 1. 2. 2.
BR 4. 2. 3. 1.
UN 0.104 0.124 0.157 0.143

Sequences

Field Description
UTR seq + 25 cacgaggggacgcggccgaggagggucgcuguccacccgggggcgugggagugagguaccagauucagcccauuuggccccgacgccucuguucucggaauccgggugcugcggauugaggacugcaagATGGAGGAAGGCGGGAACCTAGGAG
UTR dot + 25 ..((.((((((((((((……)))))).)))).))))((((((((((..((((……..)))).)))))…)))))..((((((((((((((..(((((…….))))))))))))………..))).))))…………
RS 1 seq UGUCAGUUUCAGGGAAGGUGCAAUUCCUUACUGGCGGUGAUGCCGCAUCCGGGAUUCAUAACGGAAAUGCAGGCGAGCCCGCGACCCGCGAGAGCGGCCGAUUCGGUGAGAAUCCGAAGCCAACGGUUACAGUCCGGAUGGAAGAAACGAGGG
RS 1 dot .((((((…((((((…….))))))))))))(((..(((((((((((……….))))..))).)))).)))……((((….))))((.((((((…….(((…….)))…….))))))))…………
RS 2 seq UCAAAUCGGUUAGCGCCCGGACCCGGUUGUCGGGUUGACGAGGAGCGAGGCUAUCGAAAUUUCGGCGGAUGCUUCGUCGUAUUGCCUUUGAUGCGCCGAAAAAGGCAAAACCGUAGGGUAACUUGCGGCACAAAUUCUUUUUCACAAAGGUAU
RS 2 dot …………((.((((((((((…..))))))..)).)).))..((((((((((…..(((.(((((……))))))))))))))).)))((((((((…..(((((((….)))))))…….))))))))……….
RS 3 seq UACGGUCUUCAGGGCGAGGUGAAACUCCUCACUGGCGGUAGCGCGAAAUCUUCUGCAAGGAAGCAAUUGCGAAGCCCGCGACCCUUGUGCAAGCAAGGCUGAUCUGGUGAAAAUCCAGAGCCAACGGUUACAGUCCGGAUGGAAGAAGACGAUG
RS 3 dot ..((((…..(((.(((……))))))))))(((((..(((((…(((((….)))))…)))))..))).))…((((((….))))))….(((((…….))))).(((.(((…….)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table