Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110922 Similarity: 0.937 Similarity: 0.937 Similarity: 0.937
UTR: 5HSAA110922
Gene: TMEM205_1
MFE: -86.062
ENS: 0.931
Length: 208.
Predicted Ligands:
cobalamin - 18/20
alanine - 1/20
glucosamine - 1/20
 RS: URS0000492A91_224308
MFE: -63.815
Ligand: alanine
Species: Bacillus subtilis subsp. subtilis str. 168 T-box riboswitch specific of alanine tRNA
 RS: URS0002327A6C_1262913
MFE: -50.068
Ligand: cobalamin
Species: Parabacteroides sp. CAG:409 Cobalamin riboswitch
 RS: URS000232B13B_460265
MFE: -80.672
Ligand: cobalamin
Species: Methylobacterium nodulans ORS 2060 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110922 URS0000492A91_224308 URS0002327A6C_1262913 URS000232B13B_460265
Length 208. 208. 208. 208.
Similarity - 0.937 0.937 0.937
Ensemble Norm 0.931 - - -
MFE -86.062 -63.815 -50.068 -80.672
Ligands - alanine cobalamin cobalamin
Gene TMEM205 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 9.003 11.
Length SE - 0. 0. 0.
Lev Distance - 81. 80. 79.
UBS 14. 14. 12. 15.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 3.
ILR 2. 2. 2. 4.
H 6. 7. 7. 6.
BL 3. 2. 3. 4.
BR 4. 3. 2. 5.
UN 0.091 0.082 0.144 0.106

Sequences

Field Description
UTR seq + 25 gggaaacccacgaggggacgcggccgaggagggucgcuguccacccgggggcgugggagugagguaccagauucagcccauuuggccccgacgccucuguucucggaauccgggugcugcggauugaggucccgguuccuaacgagcugggaggcgggacgaauuauugguugggacugcaagATGGAGGAAGGCGGGAACCTAGGAG
UTR dot + 25 (((…)))….((((((((((((……)))))).)))).))((((((((((((((((.(((……….)))))))….))).)))))))))..((((..(((((…….)))))))))((((((.((((((……)))))).))))))……….(((((.((((………….))))…)))))…
RS 1 seq GAAUCUCGAGUGACGGAUCUGAGUACGCCGAAGCCCUGUUAAAGAGAGAAGCUCCAUAAGCUGAAAGGAGCUUUAUCAGAAGAUCGGAGGAAGCUAAUCCUGAGUGCAGUUAAUCACUGCCGCUUAUCCUGCGUUACAGGGUUAAAGGUGACGGGCGCAUGAAUGCCCGUAAUCAGGGUGGUACCGCGAGACAGCUCUCGUCCCUGUG
RS 1 dot …..(((.(((((……..)).))))))…((.(((…((..((((((((………..)))))))).))….))).))((((……))))….(((((…..)))))(((((((((((…..))))))…)))))(((((((……)))))))…(((((…….((((((….)))))))))))..
RS 2 seq UACAUUUGUCGUUGUAUUGGUGAAACAAAAGCUAUUUCGGCUUUUGAUUUGAAAAGGGAAUCCGGUUGAAAUCCGGAACAGUGCCCGCUACUGUGACAUCUAAAGGUGAAAAGAUAAGCACUUUGAAGCCACUAUUUCUGUAACAGAGGAAUGGGAAGGCUAUCUUUUUUGAUGGAGUCAGGAAACCUGCCAUACAAAUCAGGAAAAG
RS 2 dot ((((……..))))…..(((.((((((((…..)))))))).)))……….(((((…….)))))((((((…..))))))……..((((((……….))))))..((((.((((((((…….))))))))…)))).((((.((((((((…((((…)))))))).))))..))))….
RS 3 seq CAAAGGUCUCGUUGCCAAGGUUCCCGUGGGUUCGUGCCUGCGGGAUAAGAGGGAAUUCGGUGGGCUCUCAAGGAGCGAAGCCGAAGCUGCCCCCGCAACUGUAAGCGGCGAGCUCUGCCGAACACGGUCACUGGUGCGUAGCACUGGGAAGGCCAGGCAGAAGCGGCGACCCGCGAGCCAGGAGACCUGCCUUGGCAUGGUCACGACU
RS 3 dot ….(((……)))…..((((((((((….))))))))))…..(((..((((((..(((((…)))))…))))))….)))((((……..))))…((((((((……((((.(((((((…)))))))…)))).)))))).)).(.((((.(((((.((((…)))).)))).)..)))).)….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table