Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA110937-1 Similarity: 0.970 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA110937-1
Gene: TMEM208
MFE: -48.429
ENS: 0.853
Length: 141.
Predicted Ligands:
TPP - 6/20
molybdenum - 5/20
cobalamin - 4/20
 RS: URS0000AB7E97_4096
MFE: -47.721
Ligand: Ni/Co
Species: Nicotiana sylvestris (wood tobacco) TPP riboswitch (THI element)
 RS: URS0000DA3AB6_3775
MFE: -51.576
Ligand: TPP
Species: Cephalotus follicularis TPP riboswitch (THI element)
 RS: URS0002333E09_1839774
MFE: -49.072
Ligand: cobalamin
Species: Streptomyces sp. Ncost-T10-10d Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA110937-1 URS0000AB7E97_4096 URS0000DA3AB6_3775 URS0002333E09_1839774
Length 141. 140. 140. 141.
Similarity - 0.970 0.967 0.967
Ensemble Norm 0.853 - - -
MFE -48.429 -47.721 -51.576 -49.072
Ligands - Ni/Co TPP cobalamin
Gene TMEM208 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 1.002 4.002
Length SE - 1. 1. 0.
Lev Distance - 38. 43. 43.
UBS 11. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 3. 3. 3. 4.
H 3. 3. 3. 3.
BL 3. 2. 2. 4.
BR 3. 4. 3. 2.
UN 0.043 0.050 0.086 0.092

Sequences

Field Description
UTR seq + 25 caaaagcugacgacuucggucugcgccggaagugcaugagcugccgauguggugcuuagugauugcgguuucggucgcucucccguguuucccgggcuggguauuugccucgcaccATGAGCTCGATGGCACGAGCAGCGT
UTR dot + 25 …..((.(((…….))).))(((((((.(((((((((.(((…..))))))))…..)))).)))))))(((((((..(((((…((((((((((….))))………))))))..)))))))).)))).
RS 1 seq AGAAAGCACCAGGGGUGCCUGUGUCAGCUUCAAAAACCUGGCCUUAUUAGCCAGGUUAUACGCUGACUGAACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGAUAAUUCCUGCGUAGGGAGUGUGCAUUUUUUUGUUG
RS 1 dot …..(((((…)))))((((((((((……((((((((…….))))))))….))))))…))))((.((((((((.((((….((((..(((((….)))))..))))))).).)).)))))).))..
RS 2 seq GAGAAGCACCAGGGGUGCCUGUAUCUGCCUCAGCACUGGCUAAUAUGGCCGGGAAGCUGGUACUGGCGGGUCAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGUAGGGAGUGUGCAUUUUUUCUUUC
RS 2 dot ……((((…))))((((.((((((((((((.(((((((…)))))))…)))))….)))))))))))..(((((((((((((….((((..((((……))))..))))))).).).))))))))….
RS 3 seq GGCCCCCACAUGUAUGCUCGUGCUCGCUGUCGCCGCAGGGAAAUCCGGUGCGAAUCCGGAACUGUCCCGCAACGGUGUAUUCGGUGCGCUUUUGCGCACCCUCAAGUAAGUCCGAGGACCUGCCGACAGCGCAUCCGGCUC
RS 3 dot …….(((.((..((….))..)))))(((((..((((..(((((…….)))))….))))….)))))…((((((((((.(((.(((.((((……….))))…)))))).)))))).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table