Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111257 Similarity: 0.981 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA111257
Gene: TMEM50B
MFE: -18.002
ENS: 0.980
Length: 102.
Predicted Ligands:
purine - 19/20
glycine - 1/20

 RS: URS0000C6C416_666686
MFE: -14.435
Ligand: purine
Species: Bacillus sp. 1NLA3E Purine riboswitch
 RS: URS0000DAC756_1608910
MFE: -14.638
Ligand: purine
Species: Bacillus sp. HMSC76G11 Purine riboswitch
 RS: URS0000C73768_1643452
MFE: -12.826
Ligand: purine
Species: Bacillus sp. CHD6a Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111257 URS0000C6C416_666686 URS0000DAC756_1608910 URS0000C73768_1643452
Length 102. 102. 102. 102.
Similarity - 0.981 0.981 0.980
Ensemble Norm 0.980 - - -
MFE -18.002 -14.435 -14.638 -12.826
Ligands - purine purine purine
Gene TMEM50B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 6. 4.003
Length SE - 0. 0. 0.
Lev Distance - 24. 24. 25.
UBS 6. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 2. 3. 2. 2.
H 2. 1. 1. 1.
BL 0. 1. 2. 1.
BR 2. 2. 3. 1.
UN 0.284 0.304 0.304 0.343

Sequences

Field Description
UTR seq + 25 aggcaaccguagagggcucgcgcccgccgcccgcgcgauacagcauuuaaugaaaaauuuaugcuuaagaaguaaaaATGGCAGGCTTCCTAGATAATTTTC
UTR dot + 25 ………….((((….))))((((((…….((((((((..(((…..))).)))))……)))…..))).)))…………….
RS 1 seq AGGAACUAAAAUAGCAACCUUCAUAUAUACUCGAAGAUAUGGUUCGAACGUUUCUACCAAAUCACCGUAAAUGAUUUGACUAUGAAGGCAGAUUGAUCAGUA
RS 1 dot ……………..(((((((((((…((..(((.((((..(((…))).)))).)))..))…)))…….))))))))…………..
RS 2 seq AAAUUAAUAGUACUUAUCCUUCAUAUAUCCUCGAUAAUAUGGUUCGAGAGUCUCUACCGGAUUGCCGCAAAUAAUCUGACUAUGAAGGCAGAAUAGACGAGU
RS 2 dot ……………..(((((((((((…((.((((.((((..(((…))).)))).)))).))…)))…….))))))))…………..
RS 3 seq AAAUACUCAAAUUGAACUACUCGUAUAAUCUUGGAGAUAUGGUCCAUAAGUUUCUACCAAACUACCGUAAAGAGUUUGACUACGAGAAUCCCCCUUCUUAAU
RS 3 dot ……………….(((((((((.(((…..((((((…..(((((…..)))))))))))..))).)))..))))))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table