Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111466 Similarity: 0.957 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA111466
Gene: TMEM80
MFE: -62.102
ENS: 0.963
Length: 162.
Predicted Ligands:
SAM - 7/20
TPP - 7/20
Mg2+ - 3/20
 RS: URS0000AB8F2F_196627
MFE: -41.304
Ligand: cobalamin
Species: Corynebacterium glutamicum ATCC 13032 AdoCbl riboswitch
 RS: URS0000C5976F_1736287
MFE: -62.428
Ligand: Mn2+
Species: Burkholderia sp. Leaf177 yybP-ykoY manganese riboswitch
 RS: URS0000AB4DF5_195102
MFE: -42.824
Ligand: SAM
Species: Clostridium perfringens str. 13 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111466 URS0000AB8F2F_196627 URS0000C5976F_1736287 URS0000AB4DF5_195102
Length 162. 162. 159. 164.
Similarity - 0.957 0.952 0.951
Ensemble Norm 0.963 - - -
MFE -62.102 -41.304 -62.428 -42.824
Ligands - cobalamin Mn2+ SAM
Gene TMEM80 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.007 3.005 4.007
Length SE - 0. 9. 4.
Lev Distance - 50. 51. 58.
UBS 11. 14. 12. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 1.
ILR 3. 4. 2. 3.
H 3. 3. 3. 4.
BL 4. 6. 4. 4.
BR 4. 4. 5. 3.
UN 0.136 0.049 0.063 0.055

Sequences

Field Description
UTR seq + 25 cgaacgucgguucuccaccucuucccuuccgaaagugcccgagcggugccggacggacuaaucgggccucggccguggcucggacguccgcucccgaaacgcggcgcggucgggccccuucgucaggagacgcgaaaATGCTCCCGAACGTCGGTTCTCCAC
UTR dot + 25 .((((….))))…………….((((.(.((((((.(.(((((((((((((…(((((((……..)))))))..))))).)))……..)))))).)))))).).))))…(((((..(((……………)))..)))))..
RS 1 seq AGGACACCAUCCGUUCUUUUUCAGGGGAAUUUCGGUGAGAACCCGAAGCUGACCCGCAACCGUAUUAUGCAAUCGCUUUCACCAGGUAUUGCAUUAAGCCGGAUCACCUGAAUAAGAAAUGAGUGGCUCCAAACCGUCGAGGAUUACGGUUCUGAAGCCCGU
RS 1 dot .(((…..))).(((((.((((((.((..((((((..(((((.(((((.((…(((………)))..)))))))…..)))……))..)))))))).)))))).)))))….(.((((.((((((((……..)))))).)).)))))..
RS 2 seq UUGUCCGUCUUUGGGGAGUAGCCGGCUUCCAGCCAUUGGAAGCGCUCAUGUCAACACGCUUGGUUCUCUGGACCAUGGCAUGAGCAACCGAAAUGUAUUCUGGUUGGCAAGACCAUCGAUGUAACGCCGCGACCGGUCGGGCUCGGCGUCACAUCGCAU
RS 2 dot ((.((((….)))).))…..((((((((((((((((….((((((((((…….((((((…))))))))))))))))..))))………))))))).))).))..((((((.((((((.(.((…..))).)))))).))))))…
RS 3 seq AUCUUAUCAAGAGAGGUGGAGGGACUGGCCCUGUGAAACCCAGCAACCGGUAAUUCUUUGCGGUUAAAACAAUGCUGAUUUUAAAAUAAAAAAAUCAGUAGUAAUUUCCUAUGCAAAGAUUUAUAGCGGUGCUAAAUCCUGCGGUAGAAACUGAGAGAUAAGAA
RS 3 dot .((((…..))))((((.((((…..)))).)…))).(((.((((((((.((((((((……….((((((((((……..))))))))))………..)))))))).))))..)))))))..(((((.((((….)))))).)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table